ID: 913249539

View in Genome Browser
Species Human (GRCh38)
Location 1:116901118-116901140
Sequence TGTGTGGCATACAGAATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913249539_913249541 1 Left 913249539 1:116901118-116901140 CCTGGCATTCTGTATGCCACACA No data
Right 913249541 1:116901142-116901164 GTGCCAAACGCTGCAGCACAAGG No data
913249539_913249543 5 Left 913249539 1:116901118-116901140 CCTGGCATTCTGTATGCCACACA No data
Right 913249543 1:116901146-116901168 CAAACGCTGCAGCACAAGGATGG No data
913249539_913249544 6 Left 913249539 1:116901118-116901140 CCTGGCATTCTGTATGCCACACA No data
Right 913249544 1:116901147-116901169 AAACGCTGCAGCACAAGGATGGG No data
913249539_913249547 13 Left 913249539 1:116901118-116901140 CCTGGCATTCTGTATGCCACACA No data
Right 913249547 1:116901154-116901176 GCAGCACAAGGATGGGCTAGGGG No data
913249539_913249545 11 Left 913249539 1:116901118-116901140 CCTGGCATTCTGTATGCCACACA No data
Right 913249545 1:116901152-116901174 CTGCAGCACAAGGATGGGCTAGG No data
913249539_913249549 21 Left 913249539 1:116901118-116901140 CCTGGCATTCTGTATGCCACACA No data
Right 913249549 1:116901162-116901184 AGGATGGGCTAGGGGCAGGAAGG No data
913249539_913249548 17 Left 913249539 1:116901118-116901140 CCTGGCATTCTGTATGCCACACA No data
Right 913249548 1:116901158-116901180 CACAAGGATGGGCTAGGGGCAGG No data
913249539_913249550 30 Left 913249539 1:116901118-116901140 CCTGGCATTCTGTATGCCACACA No data
Right 913249550 1:116901171-116901193 TAGGGGCAGGAAGGCAGCACAGG No data
913249539_913249546 12 Left 913249539 1:116901118-116901140 CCTGGCATTCTGTATGCCACACA No data
Right 913249546 1:116901153-116901175 TGCAGCACAAGGATGGGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913249539 Original CRISPR TGTGTGGCATACAGAATGCC AGG (reversed) Intergenic