ID: 913249540

View in Genome Browser
Species Human (GRCh38)
Location 1:116901134-116901156
Sequence TGCAGCGTTTGGCACATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913249540_913249551 19 Left 913249540 1:116901134-116901156 CCACACATGTGCCAAACGCTGCA No data
Right 913249551 1:116901176-116901198 GCAGGAAGGCAGCACAGGAAAGG No data
913249540_913249554 25 Left 913249540 1:116901134-116901156 CCACACATGTGCCAAACGCTGCA No data
Right 913249554 1:116901182-116901204 AGGCAGCACAGGAAAGGGGCAGG No data
913249540_913249544 -10 Left 913249540 1:116901134-116901156 CCACACATGTGCCAAACGCTGCA No data
Right 913249544 1:116901147-116901169 AAACGCTGCAGCACAAGGATGGG No data
913249540_913249552 20 Left 913249540 1:116901134-116901156 CCACACATGTGCCAAACGCTGCA No data
Right 913249552 1:116901177-116901199 CAGGAAGGCAGCACAGGAAAGGG No data
913249540_913249555 30 Left 913249540 1:116901134-116901156 CCACACATGTGCCAAACGCTGCA No data
Right 913249555 1:116901187-116901209 GCACAGGAAAGGGGCAGGTCTGG No data
913249540_913249548 1 Left 913249540 1:116901134-116901156 CCACACATGTGCCAAACGCTGCA No data
Right 913249548 1:116901158-116901180 CACAAGGATGGGCTAGGGGCAGG No data
913249540_913249547 -3 Left 913249540 1:116901134-116901156 CCACACATGTGCCAAACGCTGCA No data
Right 913249547 1:116901154-116901176 GCAGCACAAGGATGGGCTAGGGG No data
913249540_913249549 5 Left 913249540 1:116901134-116901156 CCACACATGTGCCAAACGCTGCA No data
Right 913249549 1:116901162-116901184 AGGATGGGCTAGGGGCAGGAAGG No data
913249540_913249550 14 Left 913249540 1:116901134-116901156 CCACACATGTGCCAAACGCTGCA No data
Right 913249550 1:116901171-116901193 TAGGGGCAGGAAGGCAGCACAGG No data
913249540_913249553 21 Left 913249540 1:116901134-116901156 CCACACATGTGCCAAACGCTGCA No data
Right 913249553 1:116901178-116901200 AGGAAGGCAGCACAGGAAAGGGG No data
913249540_913249546 -4 Left 913249540 1:116901134-116901156 CCACACATGTGCCAAACGCTGCA No data
Right 913249546 1:116901153-116901175 TGCAGCACAAGGATGGGCTAGGG No data
913249540_913249545 -5 Left 913249540 1:116901134-116901156 CCACACATGTGCCAAACGCTGCA No data
Right 913249545 1:116901152-116901174 CTGCAGCACAAGGATGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913249540 Original CRISPR TGCAGCGTTTGGCACATGTG TGG (reversed) Intergenic