ID: 913249541

View in Genome Browser
Species Human (GRCh38)
Location 1:116901142-116901164
Sequence GTGCCAAACGCTGCAGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913249539_913249541 1 Left 913249539 1:116901118-116901140 CCTGGCATTCTGTATGCCACACA No data
Right 913249541 1:116901142-116901164 GTGCCAAACGCTGCAGCACAAGG No data
913249538_913249541 2 Left 913249538 1:116901117-116901139 CCCTGGCATTCTGTATGCCACAC No data
Right 913249541 1:116901142-116901164 GTGCCAAACGCTGCAGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913249541 Original CRISPR GTGCCAAACGCTGCAGCACA AGG Intergenic