ID: 913249543

View in Genome Browser
Species Human (GRCh38)
Location 1:116901146-116901168
Sequence CAAACGCTGCAGCACAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913249539_913249543 5 Left 913249539 1:116901118-116901140 CCTGGCATTCTGTATGCCACACA No data
Right 913249543 1:116901146-116901168 CAAACGCTGCAGCACAAGGATGG No data
913249538_913249543 6 Left 913249538 1:116901117-116901139 CCCTGGCATTCTGTATGCCACAC No data
Right 913249543 1:116901146-116901168 CAAACGCTGCAGCACAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913249543 Original CRISPR CAAACGCTGCAGCACAAGGA TGG Intergenic