ID: 913249544

View in Genome Browser
Species Human (GRCh38)
Location 1:116901147-116901169
Sequence AAACGCTGCAGCACAAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913249539_913249544 6 Left 913249539 1:116901118-116901140 CCTGGCATTCTGTATGCCACACA No data
Right 913249544 1:116901147-116901169 AAACGCTGCAGCACAAGGATGGG No data
913249538_913249544 7 Left 913249538 1:116901117-116901139 CCCTGGCATTCTGTATGCCACAC No data
Right 913249544 1:116901147-116901169 AAACGCTGCAGCACAAGGATGGG No data
913249540_913249544 -10 Left 913249540 1:116901134-116901156 CCACACATGTGCCAAACGCTGCA No data
Right 913249544 1:116901147-116901169 AAACGCTGCAGCACAAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913249544 Original CRISPR AAACGCTGCAGCACAAGGAT GGG Intergenic