ID: 913249545

View in Genome Browser
Species Human (GRCh38)
Location 1:116901152-116901174
Sequence CTGCAGCACAAGGATGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913249538_913249545 12 Left 913249538 1:116901117-116901139 CCCTGGCATTCTGTATGCCACAC No data
Right 913249545 1:116901152-116901174 CTGCAGCACAAGGATGGGCTAGG 0: 1
1: 0
2: 0
3: 21
4: 262
913249539_913249545 11 Left 913249539 1:116901118-116901140 CCTGGCATTCTGTATGCCACACA No data
Right 913249545 1:116901152-116901174 CTGCAGCACAAGGATGGGCTAGG 0: 1
1: 0
2: 0
3: 21
4: 262
913249540_913249545 -5 Left 913249540 1:116901134-116901156 CCACACATGTGCCAAACGCTGCA No data
Right 913249545 1:116901152-116901174 CTGCAGCACAAGGATGGGCTAGG 0: 1
1: 0
2: 0
3: 21
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913249545 Original CRISPR CTGCAGCACAAGGATGGGCT AGG Intergenic