ID: 913249548

View in Genome Browser
Species Human (GRCh38)
Location 1:116901158-116901180
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913249538_913249548 18 Left 913249538 1:116901117-116901139 CCCTGGCATTCTGTATGCCACAC No data
Right 913249548 1:116901158-116901180 CACAAGGATGGGCTAGGGGCAGG No data
913249539_913249548 17 Left 913249539 1:116901118-116901140 CCTGGCATTCTGTATGCCACACA No data
Right 913249548 1:116901158-116901180 CACAAGGATGGGCTAGGGGCAGG No data
913249542_913249548 -10 Left 913249542 1:116901145-116901167 CCAAACGCTGCAGCACAAGGATG No data
Right 913249548 1:116901158-116901180 CACAAGGATGGGCTAGGGGCAGG No data
913249540_913249548 1 Left 913249540 1:116901134-116901156 CCACACATGTGCCAAACGCTGCA No data
Right 913249548 1:116901158-116901180 CACAAGGATGGGCTAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type