ID: 913251137

View in Genome Browser
Species Human (GRCh38)
Location 1:116912601-116912623
Sequence CAGGAAGACACCAACTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913251137 Original CRISPR CAGGAAGACACCAACTGTGT GGG (reversed) Intronic
902114753 1:14112231-14112253 CAGGAAGACAGCAAATAAGTGGG - Intergenic
905401899 1:37709765-37709787 TAGGGAGACAGCAATTGTGTGGG + Intergenic
907817724 1:57936836-57936858 CAGCAAGACACCAAATGTGATGG - Intronic
912491319 1:110064334-110064356 CTGGAAGCCATCACCTGTGTGGG - Intronic
913251137 1:116912601-116912623 CAGGAAGACACCAACTGTGTGGG - Intronic
913359473 1:117963823-117963845 CATGAAGACTCCAAGTGTGGAGG + Exonic
918563298 1:185895426-185895448 CAGTAAGAGACCAAATGTCTTGG - Intronic
919262781 1:195218884-195218906 CAGGAAGCCAGCACCTGTGTCGG + Intergenic
921129388 1:212206900-212206922 TAAGAAGCAACCAACTGTGTTGG - Intergenic
1062815129 10:493743-493765 CAGTAAGACCCCGACTTTGTAGG - Intronic
1064637562 10:17385288-17385310 CAGGAAGACTCGAAGTGTGGGGG - Intronic
1072824596 10:98593729-98593751 AAGGAAGACCCCAACAATGTAGG - Intronic
1073042481 10:100617095-100617117 CAAGGAGACACCAACCGTCTAGG - Intergenic
1075557215 10:123442323-123442345 CGGGAAGACAGCAAATGTGCTGG - Intergenic
1075708697 10:124518696-124518718 CAGAAAGACCCCAACTGAGGTGG - Intronic
1078958898 11:16239753-16239775 AAGGAATGCACCAACTGTTTTGG + Intronic
1079195462 11:18322695-18322717 CAGGAAGTAACTAACTGGGTTGG - Exonic
1079711376 11:23686979-23687001 TAGGAAAACACAAACTCTGTAGG + Intergenic
1081644083 11:44777890-44777912 CAGGTAGGCACCACATGTGTGGG + Intronic
1083587211 11:63869128-63869150 GAAGAAGGCACCAGCTGTGTGGG + Intronic
1084007849 11:66332603-66332625 CAGGAAGAGGCCAAAAGTGTTGG + Exonic
1084205143 11:67586746-67586768 CAGGAAGCCACTGACTGTGCTGG - Intergenic
1084943956 11:72629024-72629046 CAGGCAGACACTAACTGTTTTGG + Intronic
1086034717 11:82402706-82402728 CAGAAAGACCCCTACTGTGCGGG + Intergenic
1087074207 11:94114209-94114231 AAGGAAGAGAGAAACTGTGTCGG - Intergenic
1087417209 11:97872062-97872084 TAGGAAGACACCAGCTGGGGTGG - Intergenic
1087548030 11:99609419-99609441 CAGAAAGACCCCACCTGTCTAGG + Intronic
1088246211 11:107820543-107820565 TAGGAAGATACCAACTGTGAGGG - Intronic
1088459663 11:110069235-110069257 AAGGAAGGGAACAACTGTGTGGG + Intergenic
1089184974 11:116608584-116608606 CAGGGATAAACCAACTGTGCAGG - Intergenic
1089985452 11:122808648-122808670 AAGGAAGACTCCAGATGTGTGGG - Intronic
1090665982 11:128915134-128915156 AAGGAAGGCATTAACTGTGTTGG - Intronic
1090678124 11:129024120-129024142 CAGCAAGCCAGCAAGTGTGTGGG + Intronic
1091336133 11:134767578-134767600 CAGTAAAACACCAGCTGTGGTGG + Intergenic
1091612818 12:2025547-2025569 CAGGACGGCCCAAACTGTGTTGG - Intronic
1094291168 12:28851724-28851746 CAGGAAAACACAAACAGTGCAGG - Intergenic
1095128036 12:38505279-38505301 CAGGAAGACACCAACAAAATTGG + Intergenic
1099340098 12:81420145-81420167 TATGAAGCCACCAACTGGGTGGG - Intronic
1100810628 12:98333836-98333858 CTGGAAGACACCAAATCTGAGGG - Intergenic
1103327718 12:120132478-120132500 CAAGATGACACAAACTCTGTGGG - Intronic
1105503143 13:20989320-20989342 CAGGAAGACAGCATCAGAGTGGG + Intronic
1106486170 13:30174519-30174541 CAGGAAGACACCAACTCAACTGG - Intergenic
1107710438 13:43145653-43145675 CAGGAACACCACATCTGTGTAGG + Intergenic
1107752764 13:43586477-43586499 CAGTACTAAACCAACTGTGTTGG + Intronic
1107764821 13:43723017-43723039 TAGGAACTCACAAACTGTGTTGG - Intronic
1111845908 13:93508317-93508339 AAGCAAGTCACCAACTGTCTGGG + Intronic
1112202532 13:97290984-97291006 GAGTAAGACAGAAACTGTGTAGG + Intronic
1112562821 13:100529054-100529076 CAGGAAGACTCCAACTAGGAGGG - Intronic
1113856177 13:113446623-113446645 CATGTAGACACCAGGTGTGTTGG - Intronic
1115036009 14:28857637-28857659 CAGGAAGACACAGACAGTGGTGG - Intergenic
1118585012 14:67344296-67344318 CGGGAAGACACCAACAAAGTTGG - Intronic
1122505902 14:102231608-102231630 CAGGAGGACGCCACCTGTGGAGG - Intronic
1125539299 15:40460547-40460569 CAGGCAGACACCAAAGCTGTGGG - Intronic
1125718269 15:41832106-41832128 CAGGAAACCAGCACCTGTGTTGG + Intronic
1125782519 15:42282579-42282601 CAGGCAGGCACCAAGAGTGTTGG - Intronic
1126981480 15:54249135-54249157 CAGGAAGTCACCTGCTTTGTGGG + Intronic
1130612724 15:85376235-85376257 CAGGAAGAAATCAAATGTGTAGG - Intergenic
1130622627 15:85479520-85479542 CAGGCAGACAGCAGCTGTCTGGG - Intronic
1132025906 15:98404219-98404241 CAGGAAGAGCCCAACTGTCCGGG + Intergenic
1134404217 16:13940933-13940955 GAGGAAGACAGCACCTGAGTAGG + Intronic
1136635552 16:31520250-31520272 CAGGGAGACACCAACTGCTCAGG + Intergenic
1138417758 16:56880917-56880939 CAGGAAGAGACCACCTGTGCAGG + Intronic
1138550023 16:57742417-57742439 CACCAAAACACCAACTGTGGTGG - Intronic
1139884198 16:70197154-70197176 CAGGAAGACTCTCCCTGTGTTGG + Intergenic
1140240202 16:73193266-73193288 CAGGAAGGCACCACCTCTCTGGG + Intergenic
1140368317 16:74398342-74398364 CAGGAAGACTCTCCCTGTGTTGG - Intergenic
1142111130 16:88332315-88332337 GAGGATGACACCGTCTGTGTGGG + Intergenic
1142483640 17:233421-233443 CAGGAAAACACCAGCCCTGTGGG + Intronic
1146842627 17:36166359-36166381 CGGGAAGACACCTACCCTGTGGG - Exonic
1146854939 17:36254318-36254340 CGGGAAGACACCTACCCTGTGGG - Exonic
1146865681 17:36334058-36334080 CGGGAAGACACCTACCCTGTGGG + Exonic
1146870839 17:36378210-36378232 CGGGAAGACACCTACCCTGTGGG - Exonic
1146878198 17:36429292-36429314 CGGGAAGACACCTACCCTGTGGG - Exonic
1146882147 17:36450438-36450460 CGGGAAGACACCTACCCTGTGGG - Intergenic
1147068550 17:37934670-37934692 CGGGAAGACACCTACCCTGTGGG + Exonic
1147073723 17:37978834-37978856 CGGGAAGACACCTACCCTGTGGG - Intronic
1147080073 17:38014207-38014229 CGGGAAGACACCTACCCTGTGGG + Intronic
1147085244 17:38058372-38058394 CGGGAAGACACCTACCCTGTGGG - Exonic
1147096022 17:38138167-38138189 CGGGAAGACACCTACCCTGTGGG + Intergenic
1147101191 17:38182338-38182360 CGGGAAGACACCTACCCTGTGGG - Intergenic
1147892096 17:43724691-43724713 CAGGAGGACACAGAGTGTGTGGG - Intergenic
1148221582 17:45866164-45866186 CTTGAAGACAGCAACTGGGTGGG - Intergenic
1149845789 17:60008844-60008866 CGGGAAGACACCTACCCTGTGGG - Intergenic
1150084137 17:62265424-62265446 CGGGAAGACACCTACCCTGTGGG - Intergenic
1151416946 17:73972792-73972814 CAGGAACACACCAGCTGTTCTGG - Intergenic
1155389814 18:25323082-25323104 GAGGAAGAAAGGAACTGTGTGGG + Intronic
1157007183 18:43597111-43597133 CAGGAAGACTCCAAGTGGGGAGG + Intergenic
1162057430 19:8073101-8073123 CAGGAAGCCACCAGGCGTGTTGG + Exonic
926153848 2:10439712-10439734 CAGGAAGAGAGCAAATGTGTAGG - Intergenic
926461449 2:13134917-13134939 CATGAAGACTCCATCTTTGTGGG + Intergenic
926516302 2:13850950-13850972 CAGTGAGACACCAACTGGGAAGG + Intergenic
928703660 2:33924690-33924712 CAGGAAGACAACCACTATATAGG - Intergenic
931582945 2:63796847-63796869 TAGTAAGACACCAACTGGGGTGG + Intronic
932240164 2:70149993-70150015 CAGCCATACACCAACAGTGTTGG - Exonic
935808576 2:106773038-106773060 CAGGAAGACACCAAGCGGGGAGG + Intergenic
936014714 2:108949188-108949210 CAGGAGTACACCACCAGTGTCGG - Intronic
937643700 2:124242376-124242398 CAAGAAGACAGCATCTGGGTAGG + Exonic
938179905 2:129171015-129171037 CAGGAATAAAGCAACAGTGTTGG + Intergenic
942707394 2:178791752-178791774 CACGAAGAAACCAACTGTCCCGG + Intronic
944963248 2:204900962-204900984 CAGAAAGACTCCAATTGTTTGGG - Intronic
946128491 2:217585681-217585703 CAGGGAGTCACCAACTCTCTGGG + Intronic
947072612 2:226307645-226307667 CAGGAAGACTCCATCTATGATGG - Intergenic
947389881 2:229628105-229628127 TTGGAAGACAGCTACTGTGTTGG + Intronic
948307997 2:236963937-236963959 CAGGAGGACACCAACTGTGCAGG - Intergenic
948731165 2:239964570-239964592 CAGGAAGAAAAAAACTGTGCAGG + Intronic
948955404 2:241286493-241286515 CAGGAAGACTCCAAGTGGGGAGG - Intronic
948992938 2:241563909-241563931 CAGGCAGACCCCACCTTTGTGGG + Intronic
949028838 2:241778825-241778847 CAGGAAGACTCCAAGTGGGGAGG + Intronic
949030304 2:241792972-241792994 CAGGAAGACTCCAAGTGGGGAGG - Intronic
1168989457 20:2081571-2081593 AAGGAAGACAGAAACTGTGTTGG - Intergenic
1172503063 20:35440692-35440714 GTGGAAGAAACAAACTGTGTTGG - Intronic
1173106834 20:40144790-40144812 CAGGTAGGCACCAGCTGGGTTGG - Intergenic
1175828407 20:61949545-61949567 CTGGATGGCACCATCTGTGTGGG - Intergenic
1177209537 21:18053130-18053152 CAGGAAGAGACCAATTCTGAAGG + Intronic
1178230339 21:30776475-30776497 CAGCATGACACCTACTGTGAAGG + Intergenic
1178602824 21:34009640-34009662 CAGGAAAACACCATCTGCATGGG + Intergenic
1179157157 21:38860407-38860429 CAGGAAGAGCCCATCTGTGTGGG - Intergenic
1179417533 21:41210163-41210185 CAGGTTGATACCAACTGTGGAGG - Intronic
1184769846 22:46590527-46590549 CAGGCAGACACCAGCTGACTGGG - Intronic
950584833 3:13884854-13884876 GAGGAAGACACCAAGTGCCTAGG - Intergenic
956376657 3:68620423-68620445 CAGGTAGAGGCCAACTGTGCAGG - Intergenic
956884375 3:73544248-73544270 AAGAAACACACCAACGGTGTGGG - Intronic
957245051 3:77706015-77706037 CAGGATGACACTAAATGTGATGG + Intergenic
958875990 3:99617868-99617890 CAGGCAGTCACCATCTTTGTAGG - Intergenic
960740144 3:120824461-120824483 CAGGAAGGCACCAGAGGTGTGGG + Intergenic
961064075 3:123859424-123859446 CAGGAATAGACAGACTGTGTTGG - Intronic
961540013 3:127592869-127592891 CTGGAAGACACCTACCGTGGTGG - Intronic
962084524 3:132176057-132176079 CAGGAAGACACTCTGTGTGTGGG + Intronic
968122655 3:196136560-196136582 CAGGAAGAAAACAACCTTGTTGG - Intergenic
968980677 4:3847799-3847821 CAGGGAGCCAGCACCTGTGTTGG - Intergenic
971151967 4:24043042-24043064 CAGGAAGCTACCAATTTTGTAGG + Intergenic
971811134 4:31428870-31428892 TAGGAAGACACAAACTGGGGTGG - Intergenic
975246447 4:72126340-72126362 CTGGAACACACCAACAGTGTGGG + Intronic
977376900 4:96217010-96217032 CAGGAAGAGCACACCTGTGTCGG - Intergenic
978740353 4:112131041-112131063 CAGGAAAACAGCCACTGTGTAGG - Intergenic
981701224 4:147609306-147609328 CCGGAAGACCACAACTGTGCTGG + Intergenic
983814000 4:172099907-172099929 CAGGGAGTCACCAAGAGTGTTGG + Intronic
985535005 5:459707-459729 CCGGATGACACCAACTCTGTTGG + Intronic
986128380 5:4904837-4904859 CAGGAGGACACTAGCTGGGTGGG + Intergenic
988350994 5:30106812-30106834 CTGGAACAAGCCAACTGTGTTGG - Intergenic
990866464 5:60385807-60385829 CTGGAATACACCAACTTTTTAGG + Intronic
996407382 5:123119026-123119048 AAAGAAGACCCCACCTGTGTAGG + Intronic
999431797 5:151531295-151531317 CATGAAGCCGCTAACTGTGTGGG + Intronic
999789774 5:154928533-154928555 CAGCTAGATACCAGCTGTGTTGG + Exonic
1000602770 5:163295197-163295219 CCGGAGGACATGAACTGTGTAGG + Intergenic
1002701074 5:181125260-181125282 GAGGAAGAAGCCATCTGTGTAGG + Exonic
1002705020 5:181154965-181154987 GAGGAAGAAGCCATCTGTGTAGG - Exonic
1002872881 6:1183275-1183297 CAGGAAGATACCTACTGTGTTGG + Intergenic
1003115717 6:3282744-3282766 CAGTAAGTCACAAACAGTGTAGG + Intronic
1003190235 6:3868091-3868113 CAGGAAGACACCCTCTGTAGAGG + Intergenic
1004617057 6:17300764-17300786 CAGGAAGCTTCCAACTGTGGCGG + Intergenic
1006683183 6:35811819-35811841 CAGGAAGATACCCACGGTGGAGG - Intronic
1008580915 6:52906135-52906157 CATGAAGTCACCAACTAGGTTGG - Intronic
1011546542 6:88487536-88487558 CAGAAAGACACCCTCTCTGTAGG - Intergenic
1013166325 6:107595983-107596005 CAGGAAGAGACCAAAAGTGTAGG - Intronic
1013727689 6:113119918-113119940 TAGGCAGACACCTATTGTGTAGG + Intergenic
1017387161 6:153899675-153899697 CAGGAATACTCCAGCTGTATAGG - Intergenic
1018610631 6:165644554-165644576 AAGGGAGACGCCAAATGTGTAGG + Intronic
1022110327 7:27226049-27226071 AAGGAAGAGACCAACTAGGTGGG - Intergenic
1023966585 7:44966035-44966057 CAGGAAGACATCCACTATGGAGG - Intronic
1024618526 7:51136735-51136757 GAGGAAGACACCAACAGTCTTGG + Intronic
1027526466 7:79275722-79275744 CTTAAAGACACCAGCTGTGTTGG - Intronic
1027531937 7:79345531-79345553 CAGGAAGACACCAAGTCTTAAGG + Intronic
1029005074 7:97200980-97201002 CAGGAAGACACCAGCTCGATGGG + Intergenic
1029545857 7:101210259-101210281 AAGGAAGACACCAAACGTGATGG - Intronic
1034960720 7:155362717-155362739 CAGAAAGAGACCAGCTGTGAGGG + Intronic
1038879043 8:31587452-31587474 GAGGAAGATAGCAACTGTCTGGG - Intergenic
1038998408 8:32951888-32951910 CAGGAGGAAACCAACAGTCTAGG - Intergenic
1042014981 8:64299041-64299063 CAGGAAGACTCCCATTCTGTTGG + Intergenic
1043875773 8:85484502-85484524 CACCCAGACACCATCTGTGTGGG - Intergenic
1047329988 8:123878200-123878222 CAGGAAGACACGTGCTGTGCTGG + Intronic
1047707813 8:127518362-127518384 CAGTAAGTCACCAAGTGTATTGG + Intergenic
1048779791 8:137988383-137988405 AAGGAATACAGAAACTGTGTCGG + Intergenic
1050700489 9:8333111-8333133 GAAGATGACACCAAGTGTGTGGG + Intronic
1051745617 9:20292203-20292225 CAGGAAGACACCAACTATCTGGG - Intergenic
1056345975 9:85695244-85695266 CAGGAAAGTAGCAACTGTGTCGG - Intronic
1057061555 9:92008433-92008455 CAGTAAGAGACCAACTGCATGGG - Intergenic
1061968399 9:134029410-134029432 CAGGAAGACACCATCTGCCTGGG + Intergenic
1062274084 9:135722439-135722461 CAGGAAGCCACCAACCGTTTGGG + Intronic
1062613902 9:137387471-137387493 CAGGAAGCCAGCAATTGTGTGGG - Intronic
1192063366 X:67854431-67854453 CAGGAAGACTCCAAGTGGGGAGG - Intergenic
1194884069 X:99291095-99291117 CAGTAATACACTAGCTGTGTAGG - Intergenic
1196388972 X:115189978-115190000 CGGGAAGGCACCGACTGTGTCGG + Exonic
1197509194 X:127350178-127350200 CAGGAGGACAAGAAGTGTGTGGG + Intergenic
1198092253 X:133343077-133343099 CAGGTAGACAGCCACTGTGGGGG + Intronic