ID: 913251289

View in Genome Browser
Species Human (GRCh38)
Location 1:116913615-116913637
Sequence CAGGGGAAACAATCAGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913251289_913251302 30 Left 913251289 1:116913615-116913637 CCCTACTCTGATTGTTTCCCCTG 0: 1
1: 0
2: 2
3: 23
4: 222
Right 913251302 1:116913668-116913690 ACAATGTCCCTATTACGAATAGG 0: 1
1: 0
2: 0
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913251289 Original CRISPR CAGGGGAAACAATCAGAGTA GGG (reversed) Intronic
903441314 1:23390050-23390072 CAGGGGAAAGCAACAGGGTATGG + Intronic
904816380 1:33203930-33203952 CAGGGGAAACAGTCAGTAAAAGG - Intergenic
904928390 1:34066473-34066495 GAGGGGAAATAATCAAAGTTTGG + Intronic
907790323 1:57657381-57657403 TAGGGGAACCAATCACAGTACGG + Intronic
907915442 1:58864554-58864576 CATAGGAAACAATCACATTAAGG - Intergenic
908248120 1:62243859-62243881 TAGGGGAACCAATCAGAGTAGGG - Intronic
908657699 1:66405387-66405409 CAGGGGAAGCAATGACAGGAGGG - Intergenic
909554238 1:76935299-76935321 TAGGGGAAAAAATCAGATTATGG + Intronic
911272297 1:95817343-95817365 CTGGAGAAACAAGCAAAGTAGGG + Intergenic
912702806 1:111890793-111890815 CTGGAGAAAAAATCAGAGTGTGG + Intronic
912709623 1:111941135-111941157 CAGGGTTAAAAATCAGAGCAGGG + Intronic
913251289 1:116913615-116913637 CAGGGGAAACAATCAGAGTAGGG - Intronic
913308700 1:117462513-117462535 CAGGGCATACACACAGAGTAGGG + Intronic
916996795 1:170309876-170309898 AAGGGGAAACAGTCTCAGTAGGG - Intergenic
917634292 1:176919900-176919922 CAGGGGAAACCAGCATAATAGGG - Intronic
918517181 1:185375954-185375976 CAGGGAAAACAATCCGAGAAAGG - Intergenic
918807746 1:189071323-189071345 CAGGGGAAGCAAAGGGAGTAGGG + Intergenic
921729821 1:218565420-218565442 AAGGGGAAACAATCACACAAAGG + Intergenic
922611806 1:226936046-226936068 CAGGCACAACAATCAGAGTGAGG + Intronic
923806519 1:237263929-237263951 AAGGGGAAAAAATAAGAGAAGGG + Intronic
1063143133 10:3273782-3273804 CAGGGGAAACGAGGAGAGGATGG + Intergenic
1063422126 10:5921341-5921363 TGGAGGAAACCATCAGAGTAAGG + Exonic
1063773260 10:9228817-9228839 CAGGAGAAACAATCAGCATCAGG + Intergenic
1063964191 10:11333118-11333140 CAGAGGAAACACTGAGGGTAGGG + Exonic
1067287305 10:44915899-44915921 CAGGGGGAACTATCACAGTAGGG + Intronic
1067422989 10:46174111-46174133 CAGGGGAAATTAACAAAGTATGG + Intergenic
1068161085 10:53264947-53264969 CAGGGGAATCAGTCAGAGGGAGG - Intergenic
1068640792 10:59404458-59404480 ATGGGGAAAGAATCAGAGAAGGG + Intergenic
1069605570 10:69736874-69736896 CAGGGGGAAGACTCAGAGTAGGG - Intergenic
1069839665 10:71331713-71331735 TAGGGGAAACAGGCAGAGCAGGG - Intronic
1070191522 10:74115919-74115941 GAGGGGAAATAAGGAGAGTAAGG - Intronic
1070896924 10:79992230-79992252 CTGGGTAAACAATGAAAGTAGGG - Intergenic
1073035966 10:100564467-100564489 CAGGGGAAAGAAACAGGGTTGGG + Intergenic
1077354215 11:2107553-2107575 CAGAGGAACAAATCAGAGCATGG - Intergenic
1077961418 11:7080033-7080055 CAGGGGGAACACAGAGAGTAAGG + Intergenic
1079156836 11:17955791-17955813 CAGGGCAAAGAATCAGAGCAAGG + Intronic
1080080337 11:28209784-28209806 AAGTGGAAACATTCAGAGCATGG + Intronic
1082105883 11:48221350-48221372 CAGGGGACAGAAGCAGAGAAAGG + Intergenic
1082969751 11:59007095-59007117 CAGGAGAAGAAATCAGATTATGG + Intronic
1083373356 11:62199489-62199511 CAGGTGAATCAATGAGAGCATGG - Intergenic
1085079135 11:73619523-73619545 CTGGGGACATAATCAGAGGATGG - Intergenic
1085312528 11:75525112-75525134 CAGGGGAAACAAGCAGAGGCTGG - Intronic
1085897070 11:80652893-80652915 CATGGGAAAGAAACAGAATAAGG + Intergenic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1086395967 11:86415297-86415319 CAGAGGACACAAAGAGAGTAAGG + Exonic
1088009436 11:104981570-104981592 CTGGGGAAGCTATCTGAGTAGGG + Intergenic
1090966261 11:131599977-131599999 CAAGGAAAACAATCAGCCTAAGG - Intronic
1091616775 12:2055510-2055532 CAAAGAAAACAACCAGAGTAAGG - Intronic
1091966325 12:4745462-4745484 CAGGAGACACAATCACAGTGCGG - Exonic
1093823459 12:23651669-23651691 CTGGGGAAAGAATCAGAGGAGGG + Intronic
1094439083 12:30454990-30455012 CAGTGGACACAATCAGGGTGGGG - Intergenic
1094691800 12:32776696-32776718 CAGGGGAAACAGACAGTGAACGG + Intergenic
1095351726 12:41221705-41221727 CAGGAGAAAAAATCTGATTAAGG + Intronic
1097155695 12:57010639-57010661 CAGGGGGAGCATTCATAGTAGGG - Intronic
1098656861 12:73042170-73042192 CGGGGGAAAAAATAAGAGTATGG + Intergenic
1099246975 12:80203684-80203706 GAGGGGAAAGAAACAGAGGATGG - Intergenic
1103191337 12:119004641-119004663 CAGGGAAATTGATCAGAGTATGG + Intronic
1103652031 12:122440449-122440471 CAGAGGAAAATAGCAGAGTATGG - Intergenic
1106639158 13:31564844-31564866 CACTGGAAACAATCAGATTCTGG + Intergenic
1107073045 13:36292808-36292830 CAGGGAAAACAGACAGTGTAGGG + Intronic
1109617766 13:64859152-64859174 CAGGGGAAAGAGTGGGAGTAGGG - Intergenic
1110565722 13:76955874-76955896 CAGGATGAACAGTCAGAGTAAGG - Intronic
1110599494 13:77356069-77356091 CATGGGAAACAGTCAGGATATGG - Intergenic
1111780395 13:92716358-92716380 CAAGGCAAACAAGCAGAGGAAGG - Intronic
1111820090 13:93203134-93203156 CAGGGGAAAGAATGGGAGTAGGG - Intergenic
1114594939 14:23903703-23903725 CAGGGGAAACACTGAAAGTTGGG + Intergenic
1115542865 14:34439075-34439097 CAGGGGAAATAAGCTAAGTAGGG + Intronic
1115654450 14:35429941-35429963 CAGGGGAAACAAATAGAGAAGGG + Intergenic
1117907717 14:60608008-60608030 CAAGGGATACAATCTGAGAATGG - Intergenic
1119973760 14:79002361-79002383 CAGGGGATAGGATCAGAGGAGGG - Intronic
1120333826 14:83128035-83128057 CAGGGGAAATAATCACACAATGG + Intergenic
1120932170 14:89859767-89859789 CAGAGGAAACAGGCAGAGGAGGG + Intronic
1121604807 14:95232832-95232854 CAGGGGGAACAACCAGACTATGG - Intronic
1123876994 15:24633424-24633446 CAGGGGGAACACAGAGAGTAAGG + Intergenic
1123937016 15:25198947-25198969 CAGGGGAACCAATCAGCTCATGG - Intergenic
1126020342 15:44394306-44394328 CAGGGGATACATTCTGAGAAAGG + Intronic
1126092159 15:45062300-45062322 CAGGGGTGAGAATCGGAGTAGGG - Intronic
1127518910 15:59723822-59723844 GAGGGGACACATTCAGACTATGG - Intergenic
1129880410 15:79003048-79003070 CAGGAGAAACCCTGAGAGTAGGG + Intronic
1131981994 15:98003349-98003371 GAGGGGAAGTCATCAGAGTATGG - Intergenic
1133026843 16:2992311-2992333 CAGGGGAAACAGTCAAGATAGGG - Intergenic
1133668111 16:7990690-7990712 AAGGGGAAATAAACAGAGGATGG - Intergenic
1134570367 16:15285377-15285399 CAGGGAAAAGAAGCAAAGTATGG + Intergenic
1134732010 16:16470676-16470698 CAGGGAAAAGAAGCAAAGTATGG - Intergenic
1134935429 16:18241287-18241309 CAGGGAAAAGAAGCAAAGTATGG + Intergenic
1136525380 16:30826227-30826249 CAGGGAAGACAAGCAGAGTAAGG - Intergenic
1138120775 16:54399407-54399429 AGGGGGAAAAAATTAGAGTAGGG + Intergenic
1138583045 16:57953995-57954017 CAGGGAAAGCAATCAAAGCAGGG - Intronic
1138806993 16:60101656-60101678 GAGTTGAAACAATCAGATTAAGG - Intergenic
1139448258 16:67011864-67011886 CAGGGGGAACCATCAGAGGCAGG - Intergenic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140118597 16:72064356-72064378 TAGGGGAAACACAGAGAGTAAGG - Intronic
1141946026 16:87310739-87310761 CAGGGGAGAGAGTCAGAGGAGGG + Intronic
1143775868 17:9198400-9198422 AAGGGCAAACATTCAGAGAAGGG + Intronic
1146298881 17:31672732-31672754 CAGGGGGTAAAATCAGAGAAGGG - Intergenic
1148249276 17:46061129-46061151 CAGTGGAAACCATCAGTGTTTGG - Intronic
1150007639 17:61479576-61479598 CAGGAGAAAGAATCAGAGGGTGG + Intronic
1151775323 17:76197261-76197283 CAGGAGAAACAGTTACAGTAAGG + Intronic
1153448683 18:5201207-5201229 CAGTGGAAAGAATCAGGGAATGG - Intergenic
1155911061 18:31504755-31504777 CTGGGGAAAGTATCTGAGTAGGG - Intronic
1158708638 18:59817411-59817433 CTGGGGCGACAATCAGATTAGGG + Intergenic
1159778257 18:72628889-72628911 AAGGGGAAATAATGAGAATATGG - Intronic
1161009776 19:1954619-1954641 CAGTGGAGACAGTCAGAGAAGGG + Intronic
1162522775 19:11191718-11191740 CAGGGAAAACAAGAAGAGAAAGG + Intronic
1163157100 19:15445561-15445583 CTGGGGAGAAAATCAGAGCATGG - Intronic
1165311877 19:35033423-35033445 CAGGGGACAGAATCAGGGTCAGG + Intronic
1166337316 19:42116294-42116316 CAGGGGACACGATGAGGGTAGGG + Intronic
929269111 2:39953457-39953479 CAGGGAAAACAGTAAGAGAAAGG + Intergenic
929940989 2:46333867-46333889 CAAGGGAAACAAACAGAAGATGG + Intronic
931453395 2:62387567-62387589 CCTGGGAACCAACCAGAGTATGG - Intergenic
932137025 2:69240326-69240348 AATGGGAAACATTTAGAGTAGGG + Intronic
933252806 2:80047717-80047739 CAGGGGAAGGATTCAGGGTAAGG + Intronic
933826785 2:86168844-86168866 CAGGGGATACAACAAGAGAAAGG + Intronic
933918055 2:87016767-87016789 CAGGGGAACTGATCAGAGTTGGG - Intronic
934004940 2:87753147-87753169 CAGGGGAACTGATCAGAGTTGGG + Intronic
935415334 2:102810398-102810420 CTATGGAAACAATCACAGTATGG - Intronic
935767896 2:106387178-106387200 CAGGGGAACTGATCAGAGTTGGG + Intergenic
938320626 2:130359882-130359904 CAGGGGAAGCAGTCAGAATAGGG - Intronic
938755737 2:134377395-134377417 GGGGGGAAAGAATCAGAGGAAGG - Intronic
939190773 2:138914310-138914332 AAGGGGAAACAGTCAGATTTGGG - Intergenic
941281528 2:163557986-163558008 GAGAGGAACCAATCAGAGAATGG - Intergenic
941542343 2:166802342-166802364 CAGTGGAAACCATCTGAGTTGGG - Intergenic
941894191 2:170612990-170613012 CAGGGGCAACACTCAGCTTAGGG + Intronic
943980919 2:194549129-194549151 CAGGAGAAAGAATCACAGTGGGG - Intergenic
944303233 2:198149026-198149048 CAGTGGAATGAAGCAGAGTATGG - Intronic
944932050 2:204529859-204529881 CAGGGGCAACAAGCAGAGGCTGG - Intergenic
946560035 2:220902230-220902252 CAGGGCTAGCAATAAGAGTAAGG + Intergenic
947214241 2:227735668-227735690 CAGGGGACACAATTATAGAAGGG - Intergenic
947940821 2:234053779-234053801 CAGTGGACACAAGCAGAGAAAGG + Intronic
948234092 2:236374329-236374351 CAGGGGAAAAAATGAAAATATGG + Intronic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1169779864 20:9297363-9297385 CAGGGGAAAGGGTCAGAGTGGGG + Intronic
1171332174 20:24350118-24350140 CATGGGAACCGATGAGAGTATGG - Intergenic
1173022866 20:39282750-39282772 CAAGGGAAACAAGCAGAGGCAGG - Intergenic
1173195139 20:40908045-40908067 CTGGGGAGAGAATCAGAGAATGG - Intergenic
1175306912 20:57982503-57982525 CAGGGGAAACCAGGAGAGTTTGG + Intergenic
1177878654 21:26666796-26666818 CTGGGGAAACAATAAAATTAAGG - Intergenic
1178811250 21:35883748-35883770 CTGGGTAAATAATCAAAGTAAGG + Intronic
1179533248 21:42034341-42034363 AAGGGGAAAAAAGCAGAGAAGGG - Intergenic
1181449731 22:23011517-23011539 AAGGGGAAAGAATCAAAGTGAGG + Intergenic
949371675 3:3341433-3341455 CAGAGGAAGCACTCAGAGTGGGG - Intergenic
949501040 3:4680089-4680111 CAGGGGAAACAACCAGAAACAGG + Intronic
949844824 3:8358505-8358527 GAGGGGATAGAATCAGAGTTAGG + Intergenic
952586204 3:34895457-34895479 AAAGGGAAATAATCAGAGAATGG + Intergenic
954064158 3:48092574-48092596 CAGAGGAAACAATATGAGGAGGG - Intergenic
954582479 3:51710580-51710602 CAGAGGAGAGAATCAGGGTAGGG + Intronic
955923741 3:63985551-63985573 CTTGGGAAACACTCAGGGTAGGG - Intronic
957255099 3:77826069-77826091 CTGGGGAAAGAATGAGTGTAGGG - Intergenic
963310559 3:143706111-143706133 CAGGGGAAAAATTCAGAATATGG - Intronic
964990356 3:162803161-162803183 CAGGGGAGACATTCATAGTGAGG + Intergenic
965958378 3:174399030-174399052 AAGGGGAAAGAATCAGCGAAAGG - Intergenic
967513144 3:190336039-190336061 TAGGGGAAATAATAAGATTATGG + Intronic
970018840 4:11543917-11543939 CAGGGAAAACAACCAGGGGAAGG - Intergenic
971115212 4:23638285-23638307 CAGGGGAAAGAGTGGGAGTAAGG - Intergenic
971133851 4:23844966-23844988 CAGGGAAAAGAGTAAGAGTAAGG + Intronic
972356989 4:38289070-38289092 CAGGTAAAAAAATCAGAGTAGGG + Intergenic
972993445 4:44850995-44851017 CAAAGGAAACAATCAGTGAAGGG - Intergenic
976271241 4:83232377-83232399 CAGGGGACACAGTGAGAATAAGG - Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977036458 4:91959463-91959485 CTGGGGAAATAATCATAGGATGG - Intergenic
977723843 4:100271200-100271222 GAGGAGATAAAATCAGAGTAAGG - Intergenic
978334958 4:107657097-107657119 CAATGGAAACAAACAGTGTAAGG + Intronic
978485441 4:109248494-109248516 CAGCGGAGGCAAGCAGAGTATGG - Intronic
978536904 4:109771961-109771983 TAGGAGAAGCAATCAGAGCACGG + Intronic
978938596 4:114410427-114410449 CCAAGGAAACAATCAGAGAAGGG - Intergenic
979310273 4:119194929-119194951 CAGGGGAAACAATGCTATTAAGG + Intronic
979567181 4:122167531-122167553 CAGGAGAAGCAACCAGATTAAGG - Intronic
981642670 4:146963205-146963227 CAGGTGAAACAAACAGAGAAAGG + Intergenic
982138077 4:152291639-152291661 CATGGGAAACTATAAGAATATGG + Intergenic
984111144 4:175616284-175616306 CAGGGGAAAGGATGAGAGTGGGG - Intergenic
985116116 4:186593223-186593245 CAGGGAAAGCAATCAGAACAGGG - Intronic
987386989 5:17339274-17339296 CAGGGGAGGCAGTCAGAGTGTGG + Intergenic
988459552 5:31421358-31421380 CAGAGGCCACAATCAGAGAATGG - Exonic
989206748 5:38816743-38816765 CAGGGGAAAGAATAAAAATAGGG - Intergenic
991342791 5:65629936-65629958 CTGGGTAAACAATCAGAAAAGGG + Exonic
993704026 5:91149415-91149437 CAGGAGAAACAATGAGTGCAAGG - Intronic
995263554 5:110133645-110133667 CTGGGGAAACAATGACATTAAGG - Intergenic
995644640 5:114297888-114297910 CAGGGGAAATAATCTGACCAAGG - Intergenic
996491334 5:124101189-124101211 CATAGGAAGCAATCAGAATAAGG - Intergenic
997147220 5:131448933-131448955 CATGGGAAACACACAGAGAAGGG + Intronic
999029436 5:148274819-148274841 CATGGGAGACAATCTAAGTATGG - Intronic
999483790 5:151972709-151972731 CAGGGGAAAGAATGAGAGAAAGG + Intergenic
1001895748 5:175378722-175378744 CAGGGGAGGCAATGAGACTAGGG + Intergenic
1002667354 5:180834882-180834904 CAGGGGACACATTCAGATCATGG + Intergenic
1003940568 6:11021262-11021284 CAGGGAAAACCAACAGAGTTAGG - Intronic
1005022464 6:21431390-21431412 CAGGAGCAACAAAGAGAGTAGGG - Intergenic
1008884261 6:56414801-56414823 CAGGGGATCCAATCACAGGAAGG + Intergenic
1011138150 6:84121704-84121726 CTGGGGAAACAATGAAATTAAGG + Intergenic
1013553799 6:111236228-111236250 CAGGGGAAAGGATAAGAGTGGGG + Intergenic
1014217771 6:118768964-118768986 CAGTGGAAACTTTCAGAGGAAGG + Intergenic
1014916863 6:127161120-127161142 CAGAGGAAACAATAAGAGGTGGG - Intronic
1017531339 6:155295488-155295510 AAGGAGATGCAATCAGAGTAAGG + Intronic
1018128734 6:160707319-160707341 CAGGGGAACTGATCAGAGTTGGG + Intronic
1018136613 6:160784003-160784025 CAGGGGAAGTGATCAGAGTCGGG + Intergenic
1018288779 6:162269043-162269065 CAGAGGAATCAGTGAGAGTATGG + Intronic
1020658217 7:10952438-10952460 CAGGGGAAATATTCAGTGAATGG + Intergenic
1021568028 7:22033651-22033673 CAGGGGAAATCATCAGAGCTTGG - Intergenic
1024011509 7:45270991-45271013 CAGGGGAAACAAATAGGGAAGGG + Intergenic
1024233217 7:47378538-47378560 CCGAGGAAACAAACAAAGTATGG - Intronic
1025910706 7:65826171-65826193 CAGGGGAAACACTGAGTTTAGGG + Intergenic
1026167041 7:67919524-67919546 AAGTGAAAACATTCAGAGTATGG - Intergenic
1026683591 7:72489209-72489231 CAGGGGAAACAGGCAGAACAAGG + Intergenic
1028443563 7:90892671-90892693 CAGGGGAAGGAATCCGAGGAGGG - Intronic
1029189466 7:98761487-98761509 CAGGGGAAACAGCCAGTGCAAGG + Intergenic
1030195037 7:106844922-106844944 TAGGGAAAAGAAGCAGAGTAAGG - Intergenic
1031175858 7:118349083-118349105 GAGGGCAAGCCATCAGAGTAAGG + Intergenic
1032238328 7:130142519-130142541 CAGAGGAAAGACCCAGAGTATGG - Intergenic
1038377130 8:27051967-27051989 CAGGGAAAAGAAACAGAGAAAGG + Intergenic
1038836711 8:31133166-31133188 CAGGGGAAAAAATCATATAAAGG - Intronic
1039916721 8:41865610-41865632 GAGGGGAGAGAATCAGAGGAGGG - Intronic
1042830649 8:73024493-73024515 AAGGGAATACAATCAGATTATGG + Intronic
1042894505 8:73651586-73651608 CAGGGGACAGCATCAGAGTCTGG - Intronic
1043524274 8:81079598-81079620 CAGGAGAGACACTCAGAGTTGGG + Intronic
1043718464 8:83512920-83512942 CAGGGTAGACAATGAGGGTACGG + Intergenic
1045014966 8:97993221-97993243 CAGAGGAAACAAACTGAGTAAGG - Intronic
1046141487 8:110099212-110099234 TAGGGGAAAGATGCAGAGTAGGG + Intergenic
1046484015 8:114861487-114861509 CAGGGGAAATAATCATTGTGTGG + Intergenic
1047004086 8:120601611-120601633 CAGGGCACACAATGAGAGTCAGG - Intronic
1047338603 8:123958615-123958637 CAGATGGTACAATCAGAGTAAGG - Intronic
1047998850 8:130359948-130359970 CAGGGGTAAGAACCAGAGAACGG - Intronic
1048682210 8:136855753-136855775 AAGTGGAAAGACTCAGAGTATGG + Intergenic
1049773699 8:144395193-144395215 CAAGGGTGACAGTCAGAGTAGGG + Intronic
1050061018 9:1709896-1709918 CATGGGAAACAATCAGGGAGAGG - Intergenic
1050756802 9:9014665-9014687 CATGGGAGACAATCTGAGGAAGG + Intronic
1052077928 9:24167236-24167258 CAAAGGAAACAAACAGAGTAAGG - Intergenic
1052417374 9:28193801-28193823 CAGTGGAAACAATCAGAGACTGG + Intronic
1055850942 9:80629262-80629284 CAGGGAAAAGAAACAGAGTTAGG - Intergenic
1056482822 9:87023148-87023170 CAGGGGAAAGAATAAAGGTAAGG - Intergenic
1057226944 9:93297424-93297446 CAGGGGAAACAGACAGTGGAAGG - Intronic
1057406232 9:94773307-94773329 CAGGGAAAACAAGCAGGGGATGG + Intronic
1057799037 9:98178596-98178618 AAGGGGAAACACTCTGAGAAAGG - Intronic
1061361273 9:130143844-130143866 AAGGGGAAAGATGCAGAGTAAGG - Intergenic
1187008445 X:15254851-15254873 GAGGGGAAACAGTCAGAGTAAGG + Intronic
1188302210 X:28518668-28518690 CAGGGCAAAGCATCAGAGTGTGG + Intergenic
1189356917 X:40316892-40316914 CAGGAGAAAAAATCTGAGTAAGG + Intergenic
1189640619 X:43067190-43067212 CAGGGGAGACAATCACTGCAAGG - Intergenic
1192824366 X:74679742-74679764 CTGGGGAAATAACCAGAGGATGG - Intergenic
1194926592 X:99832918-99832940 CACTGGGGACAATCAGAGTATGG + Intergenic
1195265948 X:103179814-103179836 TGGGGGAAACATTCAGACTATGG + Intergenic
1195619656 X:106940152-106940174 GAGGAGAAACAATCAAAGGAAGG - Intronic
1195696869 X:107673994-107674016 CATGGGAAACCTTCAGAGGAAGG + Intergenic
1196586040 X:117429198-117429220 CAGGGGAAACAATCAAGGCCTGG + Intergenic
1196942868 X:120794833-120794855 CAGGGTGAACAATAAGAATAAGG - Intergenic
1198283532 X:135167634-135167656 CAGAGGAAACAATCAAAGAGTGG + Intronic
1198764868 X:140070247-140070269 CAGGTGAAGCAATAAGAGTATGG + Intergenic
1201417654 Y:13763368-13763390 AAAGGGACAGAATCAGAGTAAGG - Intergenic
1201647310 Y:16249366-16249388 CAGGGCAAATAATCAAATTAAGG + Intergenic
1201655501 Y:16335936-16335958 CAGGGCAAATAATCAAATTAAGG - Intergenic