ID: 913251832

View in Genome Browser
Species Human (GRCh38)
Location 1:116918276-116918298
Sequence GAGGTTAGAAAACCTGTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1153
Summary {0: 1, 1: 0, 2: 19, 3: 159, 4: 974}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913251832_913251836 27 Left 913251832 1:116918276-116918298 CCTTGGACAGGTTTTCTAACCTC 0: 1
1: 0
2: 19
3: 159
4: 974
Right 913251836 1:116918326-116918348 AATGGGAATAATACCTCTCTTGG No data
913251832_913251835 10 Left 913251832 1:116918276-116918298 CCTTGGACAGGTTTTCTAACCTC 0: 1
1: 0
2: 19
3: 159
4: 974
Right 913251835 1:116918309-116918331 ACTTTCTGTCTCTGTGAAATGGG 0: 1
1: 4
2: 49
3: 296
4: 1683
913251832_913251834 9 Left 913251832 1:116918276-116918298 CCTTGGACAGGTTTTCTAACCTC 0: 1
1: 0
2: 19
3: 159
4: 974
Right 913251834 1:116918308-116918330 CACTTTCTGTCTCTGTGAAATGG 0: 1
1: 1
2: 25
3: 238
4: 1527
913251832_913251837 30 Left 913251832 1:116918276-116918298 CCTTGGACAGGTTTTCTAACCTC 0: 1
1: 0
2: 19
3: 159
4: 974
Right 913251837 1:116918329-116918351 GGGAATAATACCTCTCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913251832 Original CRISPR GAGGTTAGAAAACCTGTCCA AGG (reversed) Intronic
900009460 1:92611-92633 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
900025570 1:269187-269209 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
900035333 1:402960-402982 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
900056954 1:638713-638735 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
901707000 1:11081552-11081574 GAGGTTAAGGAACTTGTCCAAGG - Intronic
901738321 1:11326267-11326289 GAGGTTAAGTAACCTGCCCAAGG - Intergenic
901811370 1:11768484-11768506 GAGGTTAGGTAACTTGCCCAAGG - Intronic
901871597 1:12141816-12141838 GAGGTTAAATGACCTGCCCAAGG - Intronic
901882317 1:12201495-12201517 GAGGTTAAGTAACTTGTCCAAGG + Intronic
902110047 1:14070931-14070953 GAGGTTAAGAAAGCTGCCCATGG + Intergenic
902133115 1:14280922-14280944 GAGGTTAAGCAGCCTGTCCAAGG + Intergenic
902282133 1:15382383-15382405 GAGGTTAAGAAACCTATCTAAGG - Intronic
902323965 1:15686383-15686405 GAGGTTAATAAGCCTGACCAAGG - Intronic
902327197 1:15709028-15709050 GAGGTTAGGTAACTTGCCCAAGG + Intronic
902538726 1:17137169-17137191 GAGGTTAGGTAACTTGTGCAAGG - Intergenic
902556802 1:17251611-17251633 GAGGTTAAACAACTTGTCCAAGG + Intronic
902649648 1:17828352-17828374 GAGGTTAAATAACTTGCCCAAGG - Intergenic
902835203 1:19042958-19042980 GAGGTTAAATAACTTGCCCAAGG + Intergenic
903005957 1:20298991-20299013 GAGGTTAGTAAAACTGCCCAAGG - Intronic
903186119 1:21630118-21630140 GAGGTTAAGTAACTTGTCCAAGG + Intronic
903188735 1:21644410-21644432 GAGGTTAAGTAACCTGTTCAAGG - Intronic
903605121 1:24569903-24569925 GAGGTTAAGTAACTTGTCCAAGG - Intronic
903820136 1:26095430-26095452 GAGGTTAAGGAACCTGCCCAAGG - Intergenic
904049169 1:27627948-27627970 GAGGTTTGGAAACCTGCCCAGGG + Intronic
904341032 1:29834749-29834771 GAGGTTTAGAAACTTGTCCAAGG - Intergenic
904422988 1:30405997-30406019 GAGGTTAGGCAGCCTGCCCAAGG + Intergenic
904542964 1:31246034-31246056 GAGGTTAGATCACTTGCCCAGGG + Intergenic
904609959 1:31720453-31720475 GAGGTTACTTAACTTGTCCAAGG + Intergenic
904789507 1:33008267-33008289 GAGGTGAGATAACTTGTCCAAGG + Intronic
904917359 1:33979844-33979866 GAGGTTAAAGAACTTGCCCAAGG - Intronic
905219269 1:36432966-36432988 GAGGTTAAGAAACTTGGCCAAGG - Intronic
905233250 1:36528821-36528843 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
905608767 1:39329992-39330014 GAGTTTAGGTAACTTGTCCAAGG - Intronic
905709605 1:40090015-40090037 GAGGTTAAATACCTTGTCCAAGG + Intronic
905894566 1:41536856-41536878 GAGGTTAAATAACCTGCCCAAGG + Intronic
905895286 1:41541740-41541762 GAGGTTAAGTAACCTGCCCAAGG - Intronic
905916951 1:41691010-41691032 GAGGTCAGATAACTTGCCCAAGG - Intronic
905948487 1:41924572-41924594 GAGGTTATATAACTTGCCCAAGG - Intronic
906364202 1:45191671-45191693 GAGGTTAAGTAACTTGTCCAAGG + Intronic
906562299 1:46768208-46768230 GAGGTTAAGAAACTTGCCCAGGG + Intronic
906708223 1:47910265-47910287 GAGGTTAAATAAAGTGTCCAAGG + Intronic
906730250 1:48074711-48074733 GAGGTTAAACAACTTGTCCATGG - Intergenic
906791669 1:48663863-48663885 GAGGTTATATAACTTGTTCAAGG + Intronic
906803270 1:48755948-48755970 GAAGTTAGTTAACCTGCCCAAGG + Intronic
906944323 1:50282924-50282946 AAGGTTAAATAACTTGTCCAAGG + Intergenic
907062577 1:51445791-51445813 GAGGTTAAAAAACTTAGCCAAGG - Intronic
907130033 1:52088720-52088742 GTAGTTAGATGACCTGTCCAAGG - Exonic
907136763 1:52146492-52146514 GAGGGTAACAAACTTGTCCAAGG - Intronic
907391645 1:54161970-54161992 GAGGTTAAGAAACTTGCCCAAGG - Intronic
907806957 1:57830412-57830434 TAGGTTATAAAACTTGTCCAAGG + Intronic
907920704 1:58908950-58908972 GAGGTTAAGTAACCTGACCAAGG - Intergenic
907928492 1:58977143-58977165 GAGGTTAGATAGTATGTCCAAGG + Intergenic
907945439 1:59132040-59132062 GAGGTCACATAACTTGTCCAAGG + Intergenic
907956473 1:59232862-59232884 GAGGTTGGAGAACTTGCCCAAGG - Intergenic
908285644 1:62596259-62596281 GAGGTTAAGTAACTTGTCCAAGG + Intronic
908324724 1:63012597-63012619 GAGGTTACATAACTTGTCCAAGG - Intergenic
908377428 1:63558460-63558482 GAGGTTAAGTAACCTGACCAAGG + Intronic
908465741 1:64392218-64392240 GAGGTTAAATAACCTGTCCAAGG + Intergenic
908512751 1:64862327-64862349 GAGGTTAAGTAACCTGTCCAAGG - Intronic
908702510 1:66917940-66917962 CAGGTCAGAAACCCTGTACAGGG - Intronic
908800627 1:67876464-67876486 GAGATTAGATAACTTGCCCAGGG - Intergenic
908804567 1:67916786-67916808 GAGGTTAAACAACTTGCCCAAGG - Intergenic
908839656 1:68266159-68266181 GGGGTTAGAAAACAAGTCTAGGG - Intergenic
908915851 1:69125600-69125622 GAGGTTGAATAACTTGTCCAAGG + Intergenic
908953809 1:69596262-69596284 GAGGTTAGATAACTTGATCAAGG + Intronic
909317201 1:74238283-74238305 GAGATTAAAAAACATATCCATGG - Intronic
909866088 1:80673573-80673595 GAGGTTAAAAAATCTGCCCTTGG + Intergenic
909981898 1:82113076-82113098 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
910461901 1:87456646-87456668 GAGGTATGAAAACCTATACATGG - Intergenic
910688608 1:89942911-89942933 GAAGTTACACAATCTGTCCAAGG + Intergenic
910729700 1:90381109-90381131 TAGGTCAAATAACCTGTCCAAGG + Intergenic
911329381 1:96509768-96509790 GAGATTAAATAACTTGTCCAAGG + Intergenic
911502469 1:98705372-98705394 GAAGTTAGAAAACTTGTCCTGGG - Intronic
912159599 1:106965673-106965695 GAGGTAAGAAATCCTGTACCAGG - Intergenic
912209188 1:107540178-107540200 AAATTTAGAAAACATGTCCATGG - Intergenic
912407708 1:109454399-109454421 CAGGTTAGGAACCCTGTACAGGG + Intergenic
912542986 1:110431013-110431035 GAAGTTAGGTAACCTGGCCAAGG + Intergenic
912558134 1:110530849-110530871 GAGGTTAGGTAATTTGTCCAAGG - Intergenic
913093319 1:115494572-115494594 GAGGTTAGTTAACTTGCCCAAGG - Intergenic
913251832 1:116918276-116918298 GAGGTTAGAAAACCTGTCCAAGG - Intronic
913271519 1:117098404-117098426 GAGGTTAAATAACTTGCCCAAGG + Intronic
913278574 1:117163293-117163315 AGGGTTAGAAAACTTGACCAAGG - Intronic
913508415 1:119540484-119540506 GAGGTTAATCAACTTGTCCAAGG + Intergenic
914358178 1:146906579-146906601 GAGGTATGAAAACCTATGCATGG - Intergenic
914958540 1:152186185-152186207 GAGGTTAAACAACCTACCCAAGG + Intergenic
915212002 1:154317162-154317184 CAGGTCAGAAACCCTGTACAGGG - Intergenic
915281608 1:154826440-154826462 GAAGTTAGGTAACTTGTCCAAGG + Intronic
915307125 1:154986934-154986956 GAGGTTGAGAAACCTGCCCAGGG + Intronic
915336738 1:155147828-155147850 GAGGTTGGAAAAGCTGGCCAGGG + Intergenic
915472936 1:156136616-156136638 GAGGTTAAATAACCTGCTCAAGG - Intronic
916078948 1:161220105-161220127 GAAGTTAATTAACCTGTCCAAGG + Intronic
916490602 1:165299046-165299068 GAGGCTAAATAACTTGTCCAAGG + Intronic
916511063 1:165472820-165472842 GAGGTTAAATAACCTGTCCCAGG - Intergenic
916552474 1:165861767-165861789 GAGGTTAACAACCTTGTCCAAGG + Intronic
916659240 1:166905967-166905989 GAGGTTGGAAAACTTTTCAAAGG - Intergenic
916933340 1:169602478-169602500 GAGGTTAAATAACTCGTCCAGGG - Intronic
917160017 1:172046697-172046719 GAGCTTAGAAATCCTATCGATGG - Intronic
917791618 1:178502826-178502848 GAGGTTAAGAAACCTGCCCAAGG + Intergenic
918136494 1:181678734-181678756 AAGGTTAGAAAATGTGCCCAAGG - Intronic
918449042 1:184641514-184641536 GAGGTTAGACAGCCTGATCAAGG - Intergenic
918992318 1:191713018-191713040 GAGGTTAATTAACCTGTCCAGGG + Intergenic
919540533 1:198839688-198839710 GAGATTAGAAAGACTGTACATGG + Intergenic
919683874 1:200462493-200462515 GAGGTCAGGAGACTTGTCCAAGG + Intergenic
919878509 1:201887814-201887836 GAGGTTAAAGAACTTGTTCAAGG - Intergenic
919982247 1:202649543-202649565 GAGGTAAAATAACTTGTCCAAGG + Intronic
920050236 1:203160169-203160191 GAGATTAGAAAACATGTCCAAGG - Intronic
920066758 1:203274565-203274587 GAGGTTAGGTAACTTGTCCCAGG + Intergenic
920289078 1:204904035-204904057 GATGTTAAATAACTTGTCCAAGG - Intronic
920390425 1:205596929-205596951 GAGGTTAGAGAACTTGTCTAAGG + Intronic
920421241 1:205835312-205835334 GAGGTTAAGAAGCTTGTCCAAGG - Intronic
920607876 1:207407713-207407735 GAGGTAATAAAACCTTTTCAGGG - Intergenic
920627175 1:207613472-207613494 GAGGTTCTCAAACCAGTCCATGG + Intronic
920958736 1:210645129-210645151 GAGGTTACACAACTTGTTCAAGG + Intronic
921155889 1:212438439-212438461 GAGTTTACATAACCTGTCAATGG - Intronic
921669643 1:217912003-217912025 GAGATTAAGAAACCTGCCCAAGG + Intergenic
921684544 1:218074989-218075011 GAGGCTAAGAAACCTGTCCAAGG - Intergenic
921926709 1:220716479-220716501 CAGGTCAGAAACCCTGTACAGGG - Intergenic
922257865 1:223908520-223908542 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
923004241 1:230032914-230032936 GAGGTTCAAAAACTTGCCCAAGG - Intergenic
923216122 1:231849457-231849479 GAGGTTAGACAACATGCCCAAGG + Intronic
923279940 1:232433885-232433907 GAGGTTAAGAAACTTGCCCAGGG - Intronic
923538818 1:234873565-234873587 GAGGTTAAACGACTTGTCCAAGG - Intergenic
923692263 1:236206270-236206292 GAGGGTAGGTAACTTGTCCAAGG + Intronic
924252038 1:242142644-242142666 GAGGTTAAAAATCCTTTCTAGGG - Intronic
924796492 1:247296344-247296366 GAGGTTAGAAAACTTGCTTAGGG - Intergenic
924944010 1:248832908-248832930 GAGATTAAATAACTTGTCCAAGG + Intergenic
1063070323 10:2656009-2656031 GAGTTTAGAGAACTTGACCAAGG - Intergenic
1063168171 10:3482648-3482670 GAGGGGAGAAAACCTTTCCTAGG + Intergenic
1064327128 10:14361924-14361946 GAAGTTAAACAACATGTCCAGGG + Intronic
1064563100 10:16611948-16611970 GAGGTTAGGTAACTTGTCTAAGG - Intronic
1064637463 10:17384175-17384197 CAGGTCAGAAACCCTGTACAGGG - Intronic
1065353819 10:24819856-24819878 GAGGTTAAACCACTTGTCCATGG + Intergenic
1065432854 10:25676865-25676887 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
1065703105 10:28444494-28444516 GAGGTTAGGTAACCTGGGCAAGG - Intergenic
1065961610 10:30738442-30738464 GAGGTTAGAAAACCTGCTCAAGG - Intergenic
1066478737 10:35774116-35774138 GAGGTTAAGTAACCTATCCAAGG - Intergenic
1067243921 10:44520006-44520028 GAGATTAGGCAACTTGTCCAAGG - Intergenic
1067326806 10:45276371-45276393 CAGGTCAGAAACCCTGTACAGGG + Intergenic
1067763619 10:49069269-49069291 GAGGTCAGAAGACGTGGCCAGGG - Intronic
1067942303 10:50667428-50667450 GAGGTTAAAATACTTGCCCAAGG + Intergenic
1067991531 10:51218957-51218979 GAGGTTAAATAACTTGCCCAAGG - Intronic
1068141292 10:53011034-53011056 GAGGTTAGAGAATTTTTCCAAGG - Intergenic
1068157675 10:53222678-53222700 GAGGATGGATGACCTGTCCATGG - Intergenic
1068504279 10:57879709-57879731 GATTTTACATAACCTGTCCAAGG - Intergenic
1068632737 10:59314417-59314439 GAGGTTAGGGAATCTGTCCAAGG + Intronic
1068777920 10:60887965-60887987 GAGGTTAGGTAATCTGCCCATGG - Intronic
1068808959 10:61234061-61234083 CAGGTTAGAAACCCTGTACATGG - Intergenic
1068810598 10:61251564-61251586 GAGGTTACAAAACATGCCCCAGG - Intergenic
1069127246 10:64651561-64651583 GAGGTTACAAAACTTGTCCAAGG - Intergenic
1069419539 10:68234540-68234562 CAGGTTAGAAAAAGTGTCCAAGG - Intergenic
1069830161 10:71278074-71278096 GAGGTTAAGCAACTTGTCCAAGG - Intronic
1069882306 10:71601459-71601481 GAGGGTAGATAACTTGCCCACGG + Intronic
1069944294 10:71975290-71975312 GAGGTTAGGCAACTTGTCCAAGG + Intronic
1070718910 10:78743092-78743114 GAGGTTAAATAACTTGTCCAAGG + Intergenic
1070780852 10:79136645-79136667 AAGGTTAAGAAACCAGTCCAAGG - Intronic
1070828773 10:79406188-79406210 GAGGTTAAGTCACCTGTCCAAGG + Intronic
1070863548 10:79692386-79692408 GAGGTTAAAATACTTGCCCAAGG + Intergenic
1071423578 10:85526211-85526233 GAGGTTAGGAAACATGTCTATGG + Intergenic
1071689537 10:87802304-87802326 CAGGTCAGAAACCCTGTACAGGG - Intronic
1071953689 10:90733665-90733687 GAGATTAGAAAATTTATCCAAGG + Intergenic
1072613147 10:97032241-97032263 GAGGTGAAAAAACTTCTCCAGGG + Intronic
1072717715 10:97762690-97762712 GAGGTTAGGGAACCTGCCCAAGG + Intergenic
1072720684 10:97779064-97779086 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1072751469 10:97983320-97983342 GAGGTTAAATAATCTGTCCAAGG + Intronic
1072767011 10:98103347-98103369 GAGGTTAAAAGACTTGTTCAAGG - Intergenic
1072925901 10:99616791-99616813 GAAGTTATATAACTTGTCCAAGG - Intronic
1073427317 10:103463277-103463299 GAGGTTAGATGACTTGCCCAAGG - Intergenic
1073445421 10:103577476-103577498 GAGGTCTGATAACCTGCCCAAGG + Intronic
1073581186 10:104666891-104666913 GAGGTTAAATAACCTGCCTAAGG + Intronic
1073682915 10:105724355-105724377 AATGTTAGAAAACATGGCCAAGG - Intergenic
1073738436 10:106378738-106378760 CAGGTCAGAAACCCTGTACAGGG - Intergenic
1073903424 10:108249529-108249551 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1074219808 10:111425517-111425539 GAGGTTAAATCACCTGCCCAAGG + Intergenic
1074434217 10:113419964-113419986 GCATTTAGAAAACATGTCCAGGG - Intergenic
1074445598 10:113518906-113518928 GAGGTTAGGAAACCTGCCTAAGG + Intergenic
1074496211 10:113982311-113982333 GAGCTTAGAAAGTCTGCCCAAGG - Intergenic
1075150792 10:119929022-119929044 GAGGTTAAGAAACTTGCCCAAGG + Intronic
1075189729 10:120295936-120295958 GAGGTTAATAAACTTGCCCACGG + Intergenic
1075246548 10:120827430-120827452 CAGGTTAGAGATCCTCTCCATGG - Intergenic
1075247796 10:120839492-120839514 GAAGTGAGAAAACCTGGCCAAGG + Intergenic
1075896454 10:125999683-125999705 GAGGTTAGGTAGCCTGCCCAAGG - Intronic
1076459889 10:130634806-130634828 AAGGTTAACAAACCAGTCCAGGG - Intergenic
1077521545 11:3038409-3038431 GAGGTTAGGTGCCCTGTCCAGGG - Intronic
1077535936 11:3124162-3124184 GAGGTTCAGAAACCTGCCCAAGG + Intronic
1077795238 11:5484700-5484722 GAGGTTAAATGACCTGCCCAAGG + Intronic
1078156591 11:8805100-8805122 GAGATTAAATAACCTGCCCAAGG + Intronic
1078546233 11:12248967-12248989 GAGGTTCACAAACTTGTCCAAGG - Intronic
1078594042 11:12671665-12671687 GAGGCTATATAACTTGTCCATGG - Intergenic
1078609445 11:12807683-12807705 GTGGTAAGAGAACCTCTCCAGGG + Intronic
1078925235 11:15868865-15868887 GGGGTTAATAAACCAGTCCAAGG + Intergenic
1078952907 11:16155313-16155335 GAGGTTAAATAATTTGTCCAAGG - Intronic
1078952923 11:16155518-16155540 GAGGTTAAACAACTTGCCCAAGG - Intronic
1079257635 11:18846307-18846329 GAGGTTAAGAAACTTGTCCAAGG + Intergenic
1079327260 11:19504943-19504965 GAGGTTAAATGACTTGTCCATGG + Intronic
1079334216 11:19557246-19557268 GAGGTTAAGAGACTTGTCCAAGG + Intronic
1079356261 11:19732559-19732581 GAGGTTAGGTAACCAGCCCAAGG + Intronic
1079497432 11:21061519-21061541 GAGGTTAAATACCTTGTCCAAGG - Intronic
1079507823 11:21174062-21174084 GAGGTTAAGGAACATGTCCAGGG + Intronic
1079764802 11:24378618-24378640 GAGGTTAAAAAATGTGTCCATGG - Intergenic
1080226003 11:29961137-29961159 GAGCTTAGGTAACTTGTCCAAGG + Intergenic
1080773298 11:35362485-35362507 GATGTTAGATAATCTGTCCAAGG - Intronic
1080787714 11:35490856-35490878 AAGGTTAGATGACTTGTCCAAGG + Intronic
1080850099 11:36060955-36060977 GTGGTTAGGTAACCTGTCCAGGG - Intronic
1080943022 11:36940333-36940355 GAGGTTAGGAAAGTAGTCCAAGG - Intergenic
1081670094 11:44937894-44937916 GAGGTTAGGCAACTTGCCCAAGG - Intronic
1081683501 11:45025387-45025409 GAGGTTAAGAAACCTGTCTAAGG - Intergenic
1081836966 11:46163906-46163928 GAGGTTAAGAGACTTGTCCAAGG + Intergenic
1082029142 11:47592310-47592332 GAAGTTAGGGAACCTGCCCAAGG - Intronic
1082228517 11:49736828-49736850 CAGGTTAAGAAACCTGTCCAGGG + Intergenic
1082254973 11:50023791-50023813 GAGGTTAACAAACCAGTCCAGGG - Intergenic
1083413203 11:62507817-62507839 GAGGTTTGATAACTTGCCCAAGG + Intronic
1083462631 11:62824671-62824693 GAGGTTAAATGACCTGTCCAGGG - Intronic
1083478153 11:62926966-62926988 GAGGTTCAGTAACCTGTCCAAGG + Intergenic
1083478319 11:62927870-62927892 GAGGTTCTGTAACCTGTCCAAGG + Intergenic
1083611152 11:64004963-64004985 GGGGTTAAGCAACCTGTCCAAGG + Intronic
1083725935 11:64628255-64628277 GAGGCTAGATGACTTGTCCAAGG + Intronic
1083796712 11:65021169-65021191 GAGGTTAGGTAACTTGTCCCAGG + Intronic
1083831131 11:65234277-65234299 GAAGTTGGACAACCTGCCCACGG - Intergenic
1083941465 11:65898534-65898556 GAGGTTAAATAACTTGCCCATGG - Intronic
1084345303 11:68543178-68543200 GAGGTTAAGTAACTTGTCCAAGG + Intronic
1084875177 11:72126042-72126064 CAGGTTAGGAACCCTGTCCAGGG + Intronic
1084914521 11:72418449-72418471 GATGTTAGACAACTTTTCCAAGG + Intronic
1085045450 11:73350210-73350232 GAGGTTAAGAAACTTGCCCAGGG + Intronic
1085187303 11:74586825-74586847 GAGGTTAAATAACTTGCCCAAGG - Intronic
1085280429 11:75326512-75326534 GAGGTTAAATAACCTGCCCAAGG + Intronic
1085498253 11:76992813-76992835 GAGGTTAACTAACTTGTCCAGGG - Intronic
1085534085 11:77207794-77207816 GAGGTTAGGTAACTTGTCCAAGG + Intronic
1085587720 11:77726871-77726893 GAGGATATACAACTTGTCCAGGG - Intronic
1085740395 11:79073682-79073704 GAGGTTAAATAACTTGCCCAAGG - Intronic
1086051618 11:82598612-82598634 GAGGTTATGTAACTTGTCCAAGG - Intergenic
1086094269 11:83034815-83034837 GAGGTTCCATAACTTGTCCAAGG + Intronic
1086325157 11:85691372-85691394 GAAGTTAGATAACTTGTCCAAGG + Intergenic
1086507172 11:87517977-87517999 GAAGTTAGAAAACTTGTCGAAGG + Intergenic
1086621557 11:88892320-88892342 CAGATTAAGAAACCTGTCCAGGG - Intronic
1086726424 11:90190258-90190280 GAGGTTAAATAACCAGTGCAAGG + Intronic
1087593070 11:100216979-100217001 GAGTTTAGGTAACTTGTCCATGG - Intronic
1088623478 11:111710750-111710772 GAGGTTAGGAAACCTGATTAAGG + Intronic
1088787070 11:113191566-113191588 GAGGTTAAATAACCAGCCCAAGG - Intronic
1088971968 11:114781581-114781603 GAGGATAGAAAATATGACCAGGG + Intergenic
1089062922 11:115640959-115640981 GAAGTTTAAAAACTTGTCCAAGG + Intergenic
1089129655 11:116201767-116201789 GAGGTTAGGGAACTTGTCTAAGG - Intergenic
1089529549 11:119117475-119117497 GAGGTTACATAACTTGCCCAAGG - Exonic
1089738597 11:120566302-120566324 GACGTTAGGCACCCTGTCCAGGG + Intronic
1090255167 11:125278828-125278850 GAGGTCACATAACTTGTCCAAGG + Intronic
1090281470 11:125459713-125459735 GAGGTTACATGACTTGTCCAAGG - Intronic
1090298962 11:125617338-125617360 GAGGTTAAATAACTTGCCCAAGG + Intronic
1090642892 11:128744525-128744547 GAGATTAAAGAACTTGTCCAAGG + Intronic
1090760112 11:129829115-129829137 GACATTAGAGAACTTGTCCAAGG + Intronic
1091639667 12:2226363-2226385 GAGGTTAAATAACTTGGCCAAGG + Intronic
1091648589 12:2292549-2292571 GAGGTTTGATAACTTGACCAAGG - Intronic
1091747403 12:3001123-3001145 GAGGTTAAATAACTTGCCCAAGG - Intronic
1092096402 12:5845772-5845794 GAGGTTAATAAACTTATCCAAGG - Intronic
1092509596 12:9140777-9140799 CAGGTCAGAAACCCTGTACAGGG + Intergenic
1092930575 12:13311701-13311723 GAGCTGAGAAAACCTTTGCAAGG - Intergenic
1093170390 12:15853391-15853413 GAGGATAGAAATCCAGACCAGGG - Intronic
1093324000 12:17750330-17750352 GAGGTTAAATAACTTGTCAAAGG + Intergenic
1093567751 12:20628554-20628576 GAGGTTAAAAAACCCTCCCAAGG - Intronic
1093630714 12:21405873-21405895 GAGGTTAATTAACTTGTCCAAGG - Intronic
1093735717 12:22618084-22618106 CAGGTCAGAAACCCTGTACAAGG - Intergenic
1093807981 12:23457968-23457990 GAGGTTAGATTATCTGTCCAGGG - Intergenic
1094004184 12:25729891-25729913 GAGGTTAAATAACTTGTCCAAGG + Intergenic
1094179324 12:27574782-27574804 GGGGTTAAATAACTTGTCCAAGG - Intronic
1094489663 12:30951684-30951706 GAGGTTAAATAACTTGCCCAAGG + Intronic
1094491489 12:30963630-30963652 GAGGTTAGGAGACTTGTCCAAGG - Intronic
1094594329 12:31850766-31850788 CAGGTCAGAAACCCTGTGCAGGG - Intergenic
1094724398 12:33098651-33098673 GAGATTAAAATACTTGTCCAAGG + Intergenic
1095833236 12:46609827-46609849 AAGGTTAAATAACTTGTCCAAGG - Intergenic
1095921893 12:47540212-47540234 GGGGTGAGGAAACCTGCCCAAGG + Intergenic
1096073098 12:48786856-48786878 GAGGTTAAATAACTTGCCCAAGG - Intronic
1096462075 12:51827338-51827360 GAGGTCAGGCAACCTGCCCAGGG - Intergenic
1097388358 12:58978450-58978472 GAGGTCAGAAAACTTGGTCAAGG - Intergenic
1097499983 12:60389715-60389737 GAGGTCAGGAACCCTGTACAGGG + Intergenic
1097788749 12:63790798-63790820 GAGGTTAAGAAACTTGCCCAAGG - Intronic
1097812981 12:64038082-64038104 GAGGTTATGTAACTTGTCCAAGG - Intronic
1097979209 12:65719835-65719857 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
1098067826 12:66638393-66638415 GAGGTTAAATAACCTGCCCAGGG + Intronic
1098179522 12:67831363-67831385 GAGGTTAAATAACTTGTCCAAGG - Intergenic
1098334224 12:69385562-69385584 GAGGTTAAGAAACTTGCCCAGGG + Intronic
1098597211 12:72287994-72288016 GAGGTTAAGTAACTTGTCCAGGG + Intronic
1098837103 12:75436872-75436894 AAGCTTGGAAAACCTATCCAAGG - Intergenic
1098897537 12:76081236-76081258 GTGGTTAGATAACCCGTCCGTGG - Intronic
1099247976 12:80216711-80216733 GAGGTTAGGAAACTTGCCTAAGG + Intronic
1100012044 12:89965256-89965278 GAGATTAAAAAACTTGCCCAGGG - Intergenic
1100168157 12:91941561-91941583 GAGGTTAAGTAACCTGTCCAAGG - Intergenic
1100670930 12:96812068-96812090 GAGGTTACATAAACTGCCCAAGG - Intronic
1100679659 12:96905809-96905831 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
1100739181 12:97572184-97572206 GAGGTTAAATAACTTCTCCAAGG - Intergenic
1100815233 12:98380624-98380646 GAGGTTTCATAGCCTGTCCAAGG + Intergenic
1101456586 12:104837890-104837912 GAGGTTAATAAACCTGACTATGG + Intronic
1101588968 12:106109715-106109737 GAGGTTATGTAACCTGCCCAGGG - Intronic
1101752301 12:107591870-107591892 GAGGTTAAGAAACCTGCCCACGG + Intronic
1101811407 12:108111218-108111240 GATGTTAAATAACTTGTCCAAGG - Intergenic
1101819395 12:108172188-108172210 GAGGTTAGGTAACTTGTTCAAGG + Intronic
1101944440 12:109125751-109125773 GAGGTGAGGAAACTTGTTCAAGG + Intronic
1102441273 12:112965633-112965655 GAGGTTAGATGACTTGTCCAAGG + Intronic
1102580512 12:113883636-113883658 CAGGTTAGGTAACCTGGCCAAGG + Intronic
1102639805 12:114356853-114356875 GAGGTTAAGAAACTTGCCCAAGG + Intronic
1102776068 12:115520133-115520155 GAGGTTAATCAACTTGTCCAAGG - Intergenic
1102794545 12:115677166-115677188 GAGGTTAGAGCACTTGACCAAGG + Intergenic
1103152570 12:118653945-118653967 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
1103605762 12:122084982-122085004 GAGGTTACACAACTTGTCCACGG + Intronic
1103945818 12:124525823-124525845 GAGGTTAGGGGACTTGTCCAAGG - Intronic
1104711954 12:130993613-130993635 GAGGTTAAATAACCTTCCCACGG - Intronic
1104843008 12:131833622-131833644 GAGTGTGGATAACCTGTCCACGG - Intronic
1105254399 13:18732299-18732321 GAGGTCAGAAAAGTTGCCCAGGG - Intergenic
1105964287 13:25371309-25371331 GAGGTAAGATGACTTGTCCAAGG - Intergenic
1106141851 13:27018461-27018483 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1106623214 13:31391154-31391176 CAGGTTAGGAACCCTGTGCAGGG + Intergenic
1106801408 13:33260114-33260136 GGGGTTAGATAACTGGTCCATGG + Intronic
1107012546 13:35682725-35682747 GAGGTTAAATATCCTGTCCAAGG + Intergenic
1107024023 13:35781301-35781323 GTGGTTAGAAAACATGTCCAAGG - Intronic
1107355128 13:39558235-39558257 GAGGTTAGGTGACCTGTCCAAGG - Intronic
1107717842 13:43218060-43218082 GATGTTAAATAAGCTGTCCAAGG + Intronic
1107790256 13:43994788-43994810 GTGATTAGAAAAGCTGTCGAAGG + Intergenic
1107847445 13:44531431-44531453 GAGTTTACAAGACCTGGCCAAGG - Intronic
1108072484 13:46642398-46642420 GAGGTTAGGTAACTTGTCCAAGG - Intronic
1108110543 13:47066873-47066895 GAGGCTAAAAAACTTGTTCAAGG + Intergenic
1108455578 13:50610492-50610514 GAGGTTAGATAGCTTGCCCAGGG + Intronic
1108508105 13:51131443-51131465 CAGGTCAGGAAACCTGTACAGGG - Intergenic
1109865574 13:68259535-68259557 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1110373455 13:74765675-74765697 GAGGTTAAGAAACTTGTCCAAGG + Intergenic
1111028747 13:82568904-82568926 CAGGTTAGGAACCCTGTACAGGG + Intergenic
1111657054 13:91166939-91166961 GAGGTTAGCAAACTTGTCTAAGG - Intergenic
1112016278 13:95334036-95334058 GAAGTTAGACAACTTGCCCAAGG + Intergenic
1112040970 13:95547634-95547656 GAGATTAGGTGACCTGTCCAAGG + Intronic
1112383955 13:98920461-98920483 GAGGTTAAATAACATCTCCAAGG + Intronic
1112413317 13:99182361-99182383 CAGGTCAGAAAACCTGTACAGGG + Intergenic
1112483278 13:99796586-99796608 GAGGTTAACAAACTTGCCCAAGG + Intronic
1112655017 13:101442883-101442905 GAGGTTAAGAAACCTGGCCAAGG + Intergenic
1113153811 13:107294354-107294376 TAGGTTAGATAACTCGTCCACGG + Intronic
1113850367 13:113414295-113414317 GCGCTTAGAAAACATGTCCTGGG + Intergenic
1114256670 14:21008824-21008846 CAGGTCAGAAACCCTGTACAGGG - Intergenic
1114583879 14:23791669-23791691 CAGGTCAGAAACCCTGTACAGGG + Intergenic
1114689602 14:24568111-24568133 GAGTTTAGAAACCCTGTTTAAGG + Intergenic
1114879453 14:26765983-26766005 TAGGTTAGAAAACCTCTTGATGG - Intergenic
1115440423 14:33428235-33428257 GAAGTTAAAAAATGTGTCCATGG - Intronic
1115783877 14:36802541-36802563 GAGGTTAAATAATTTGTCCAAGG + Intronic
1116329853 14:43582069-43582091 CAGGTCAGAAACCCTGTACAGGG - Intergenic
1116511058 14:45747304-45747326 GAGGTTAAATAACATGTCCAAGG + Intergenic
1116812261 14:49550435-49550457 GAAGTTACACAACCTGGCCAAGG + Intergenic
1117150637 14:52884253-52884275 AAGGTTAAATAACTTGTCCAAGG + Intronic
1117191146 14:53293133-53293155 GAGGCTAAAAAGCCTGTTCAAGG - Intergenic
1117505610 14:56399740-56399762 GAGGTTCAGAAACCTGTCCAAGG + Intergenic
1117867452 14:60164922-60164944 CAGGCTAGGAAACCTCTCCAGGG - Intronic
1118569837 14:67183460-67183482 GAGATTAAGAAACTTGTCCATGG + Intergenic
1118639892 14:67782613-67782635 GGGGTTAGGAAACTTGCCCAGGG - Intronic
1118961996 14:70542442-70542464 CAGGTCAGAAACCCTGTACAGGG - Intergenic
1119490886 14:75031942-75031964 GAGGTTACAAGACTTGTCTAAGG - Intronic
1119540040 14:75431997-75432019 GAGGTTAGGGAACTTGCCCAAGG + Intronic
1119579680 14:75766540-75766562 GAGGTTAGGTAACTTGTCTAAGG + Intronic
1119583026 14:75804735-75804757 GAGGTTAAACAACTTGTCCAAGG - Intronic
1119678470 14:76574192-76574214 GAGGTTAAGGAACATGTCCAAGG - Intergenic
1119890383 14:78178090-78178112 GAGGTTAAGTAACATGTCCAAGG + Intergenic
1119980367 14:79073883-79073905 GAGGTTAAATAACGTGTCCAAGG - Intronic
1119997571 14:79270470-79270492 GAGGCTAGGTAACTTGTCCAAGG + Intronic
1120633971 14:86928377-86928399 GAGGTTATAAAACTTGCCCATGG - Intergenic
1120762339 14:88296294-88296316 GAGGGTAAAAAACTTGTCCAAGG - Intronic
1120945887 14:89996656-89996678 GAGGTTAAGAAACTTGTCCAAGG - Intronic
1121020184 14:90575310-90575332 GAGGGTGAATAACCTGTCCAAGG + Intronic
1121101987 14:91255600-91255622 GAGGTTAAAAGACTTGTCCAGGG - Intergenic
1121147321 14:91595613-91595635 CAGGTCAGAAACCCTGTACAGGG + Intronic
1121188439 14:91999080-91999102 GAGATTAAATAACCTGCCCAAGG - Intronic
1121237306 14:92401693-92401715 GAGGTTAGATAACTCGCCCAAGG - Intronic
1121495161 14:94387231-94387253 GAGGTTAAGTAACTTGTCCAAGG - Intronic
1121580207 14:95024465-95024487 GAGGTAAGGAAACCCCTCCATGG - Intergenic
1121685309 14:95831237-95831259 GAGGTTAAGCTACCTGTCCAAGG - Intergenic
1122218377 14:100219323-100219345 GAGGTTAGGTCACTTGTCCAAGG + Intergenic
1124398912 15:29331408-29331430 CAGGTCAGAACACCTGTCCGGGG + Intronic
1124490892 15:30154578-30154600 GAGGTTAGAAAGTTTTTCCAAGG + Intergenic
1124752641 15:32383753-32383775 GAGGTTAGAAAGTTTTTCCAAGG - Intergenic
1125009352 15:34853837-34853859 GAGGTTATAAAATTTGTCTAAGG + Exonic
1125259399 15:37805237-37805259 AAGGTTAGGAAACATGCCCAAGG - Intergenic
1125929066 15:43586766-43586788 AAGTTCAGAAAACCTGTTCAGGG + Intronic
1125942233 15:43686598-43686620 AAGTTCAGAAAACCTGTTCAGGG + Intergenic
1126042488 15:44605650-44605672 GAGGTTAGATCACATGACCAAGG + Intronic
1127327246 15:57907536-57907558 GAGGTTGAAAAACTTGTCCAAGG - Intergenic
1127389575 15:58494425-58494447 GAGGTTGGATGACCTGCCCAAGG - Intronic
1127654320 15:61041952-61041974 GAGGTTAAATAACTTGCCCAAGG + Intronic
1127689385 15:61379899-61379921 GAGGTTAAATTACTTGTCCAAGG + Intergenic
1127842948 15:62846313-62846335 GAGGTTAGGTAACTTGCCCAAGG + Intergenic
1128149257 15:65352505-65352527 TAGGTCAGAAACCCTGTACAGGG - Intronic
1128310559 15:66629542-66629564 GAAGTTAGATAACCTATCCAAGG + Intronic
1128450865 15:67805232-67805254 GAGGTTGGGAAACCTGCCCTGGG - Intronic
1128723616 15:69971576-69971598 GAGGTTAGGTAACATGTCCTAGG + Intergenic
1129229733 15:74190553-74190575 GAGGTTATATAACTTGCCCAAGG + Intronic
1129517020 15:76163108-76163130 GAGGTGCGGAAACCTGCCCAGGG + Intronic
1129983371 15:79895126-79895148 GAGATTATGAGACCTGTCCAAGG + Intronic
1130204056 15:81859630-81859652 GAGGTTAAAGAAACTGGCCAAGG + Intergenic
1130845976 15:87746318-87746340 GAAGTTAAGAAACTTGTCCAAGG - Intergenic
1130910204 15:88265635-88265657 GAGGTTAAATCACATGTCCAAGG + Intergenic
1131695960 15:94877734-94877756 CAGGTTAGGAACCCTGTACAAGG + Intergenic
1132315947 15:100890634-100890656 GAGGTTAAGTAACCTGTCCTAGG + Intronic
1132901852 16:2260531-2260553 CAGATTAGAAACCCTGTACAGGG - Intronic
1133455608 16:5939955-5939977 GAGGGTAAATAACCTGACCAGGG - Intergenic
1133587563 16:7210752-7210774 GAGGTTAAATGACATGTCCAAGG + Intronic
1134216054 16:12317770-12317792 GAGGTTAGGGAACATATCCAGGG - Intronic
1134686496 16:16162365-16162387 GAGGTTTGGAAACTTGTCCAGGG - Intronic
1134693712 16:16207691-16207713 GAGGTTAAGCAACGTGTCCAAGG + Intronic
1134880703 16:17743332-17743354 GAGGTTAAGAAACCTGCCCAAGG - Intergenic
1134978131 16:18586952-18586974 GAGGTTAAGCAACGTGTCCAGGG - Intergenic
1135392042 16:22101982-22102004 AAGGTTACCACACCTGTCCAAGG + Intronic
1135422791 16:22316176-22316198 GAGGTTAGCTAACATGCCCAAGG - Intronic
1135471506 16:22735658-22735680 GAGGTTACATAACTTGCCCAAGG - Intergenic
1135581230 16:23628331-23628353 GAGGTTACACAATTTGTCCAAGG + Intronic
1135901540 16:26464650-26464672 TAGGTTTGAAAACCTGCCCCAGG - Intergenic
1136104112 16:28016816-28016838 GAGGTTAAATGATCTGTCCAAGG + Intronic
1136237362 16:28922965-28922987 GAGGTTAAATAACTTGCCCAAGG - Intronic
1136385255 16:29921508-29921530 GAGCTTGGAAGACGTGTCCAAGG - Intronic
1136404864 16:30038868-30038890 GAGGTTTGGTAACTTGTCCAAGG + Intronic
1136460985 16:30409877-30409899 GCGGTTAGGAAACTTGGCCAAGG - Intronic
1137242561 16:46669274-46669296 GAGGTTGTATAACCTGCCCAAGG + Intronic
1137540232 16:49356797-49356819 GAGGTTAAAAATTGTGTCCATGG + Intergenic
1137749251 16:50846747-50846769 GAGGTCAGAAAGCCTCACCATGG - Intergenic
1137826744 16:51504184-51504206 GAAGTTAGAAAATTTGTCCCAGG - Intergenic
1138288385 16:55827011-55827033 CAGGTTAGAGAACCTGACCAAGG + Intronic
1138435530 16:56997473-56997495 GAGGTTAAGAAAACTGTCCAAGG + Intronic
1138530847 16:57633599-57633621 GAGGTTAATATACCTGTCCCAGG - Intronic
1139204899 16:65018228-65018250 CAGGTTAGGAACCCTGTGCAGGG + Intronic
1139227818 16:65250005-65250027 GAGCAGAGAAAACCAGTCCAAGG - Intergenic
1139588109 16:67917216-67917238 GAGGTTACATAACTTGGCCATGG + Intronic
1139789505 16:69421742-69421764 GAGGCTAAGAAACCTGCCCAAGG + Intergenic
1140248368 16:73271559-73271581 GAGGTTAAGGAACATGTCCAGGG - Intergenic
1140694433 16:77518396-77518418 GAGGTTAGGAGATTTGTCCAAGG + Intergenic
1140797538 16:78453572-78453594 GCAGTTAGAAAATCTGTCTAGGG + Intronic
1140873490 16:79128491-79128513 GAGGTTAAATAACTTGGCCAAGG + Intronic
1140941372 16:79724212-79724234 GAGGTTAAAAATCTTGTCCAAGG - Intergenic
1141071739 16:80962670-80962692 GAGATTTGAAAACCTGGCTATGG - Intergenic
1141158400 16:81612596-81612618 GAGGTGAGAAAAACAGCCCAGGG - Intronic
1141164564 16:81651842-81651864 GAGGTTAGAAAATCTGCCCAGGG - Intronic
1141257940 16:82420743-82420765 GAGGTTAAGAAATTTGTCCAAGG - Intergenic
1141609998 16:85175873-85175895 GAGGTTAAGCAACTTGTCCAAGG + Intronic
1141811637 16:86380000-86380022 GAGGTTAAGAAACTTGCCCAAGG + Intergenic
1141916550 16:87101185-87101207 GAGGATAGATAACTTGTCTAAGG - Intronic
1141929834 16:87194990-87195012 GAGGTTAAGGAACTTGTCCACGG + Intronic
1142601540 17:1055411-1055433 GAGGTTAAGAAACTTGCCCAAGG + Intronic
1142631316 17:1228602-1228624 GAGCTTAGAAAACACGTGCAAGG - Intronic
1142868260 17:2804402-2804424 GAGTTTAGGAAACCCGTTCAAGG + Intronic
1142870050 17:2814221-2814243 GAGGTTAAGTAACTTGTCCAAGG - Intronic
1143281380 17:5757161-5757183 GAGGGTGGACAACTTGTCCAAGG - Intergenic
1143505128 17:7359807-7359829 GAGGTTAAATAACTTGCCCACGG - Intergenic
1144160982 17:12557688-12557710 AAGGTTAGGTAACTTGTCCAAGG + Intergenic
1144192187 17:12856688-12856710 AAGCTTACAAAACTTGTCCAAGG - Intronic
1144207314 17:12988294-12988316 GAAGGTAGGAAACTTGTCCAAGG + Intronic
1144447950 17:15348635-15348657 GAGGTTAGGTAACTTGACCAAGG + Intergenic
1145032038 17:19511648-19511670 GAGGTTAAATAAACTGTCCCAGG - Intronic
1145226639 17:21134485-21134507 CAGGTCAGAAACCCTGTACATGG + Intronic
1145981302 17:29013369-29013391 GAGGTTCCAAAACTTGCCCAAGG - Intronic
1146342569 17:32033519-32033541 GAGGTTACATAACTTGTCCTAGG - Intronic
1146624086 17:34422799-34422821 GAGGTCGAGAAACCTGTCCATGG - Intergenic
1146667703 17:34715908-34715930 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1146807825 17:35879254-35879276 GAGGTTAAGTAACTTGTCCATGG - Intronic
1146889765 17:36498953-36498975 GAGGCTAAACAACCTGCCCAAGG + Intronic
1147267820 17:39245394-39245416 GAGGTTAAATAACTTGCCCAAGG + Intergenic
1147565607 17:41534817-41534839 GAGGATGGAAACCCTTTCCAGGG - Intergenic
1147568938 17:41555314-41555336 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
1147657089 17:42097211-42097233 GAGGTTAAGAAACTTGTTCAAGG + Intergenic
1148171594 17:45525599-45525621 GAGGTTATATAACTTGTCCTAGG + Intergenic
1148277777 17:46320807-46320829 GAGGTTAGATAACTTGTCCTAGG - Intronic
1148299984 17:46538662-46538684 GAGGTTAGATAACTTGTCCTAGG - Intronic
1148356633 17:46979476-46979498 TTGGCTAGAAAACCTCTCCAAGG + Intronic
1148364427 17:47042950-47042972 GAGGTTATATAACTTGTCCTGGG - Intronic
1148757571 17:49981713-49981735 GAGGTTAAGAAACTTGCCCAAGG - Intergenic
1148759479 17:49992089-49992111 GAGGTTAAACAACTTGCCCAAGG - Intronic
1148830710 17:50429177-50429199 GAGGTTAGATAACATGCCCGAGG - Intronic
1148933216 17:51143941-51143963 AAGGTTAAATAACCTGCCCAAGG - Intergenic
1149456639 17:56793634-56793656 GAGGTTAGGCAACTTGCCCAAGG + Intronic
1149483853 17:57025684-57025706 CAGGTCAGAAACCCTGTACAGGG + Intergenic
1149488726 17:57066193-57066215 GACGAGAGAAAACCTGGCCAAGG + Intergenic
1149500996 17:57152358-57152380 AAGGTTATATAACCTGCCCAAGG + Intergenic
1149641784 17:58207435-58207457 GAGGTTAAGAAACCTGTCCTGGG - Intronic
1149774580 17:59347221-59347243 GAGGTTAGGTAATTTGTCCAAGG + Intronic
1149831723 17:59878453-59878475 GAGATTAAAAAACTTGTCCAAGG - Intronic
1150227728 17:63533009-63533031 GAGGTTACAAAACTTGCCCAAGG + Intronic
1150349779 17:64434990-64435012 CAGGTCAGAAACCCTGTACAGGG - Intergenic
1150402520 17:64870635-64870657 GAGGTTATATAACTTGTCCTAGG + Intronic
1150603542 17:66671466-66671488 GAGGTTAGTTAATATGTCCAAGG + Intronic
1150624425 17:66832655-66832677 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1150836984 17:68573228-68573250 GAGGTTAGATAACTTGCCCTAGG - Intronic
1150845478 17:68653384-68653406 GAGGTTAAATAACTTGTTCAAGG - Intergenic
1151184235 17:72351552-72351574 GAGGTTAGGTAACCTGGCCAGGG - Intergenic
1151338762 17:73456358-73456380 GAGGTTAGTTAACTTGTCTAAGG + Intronic
1151400211 17:73850962-73850984 GAGGTTAAACAACCTGCTCAAGG - Intergenic
1151778726 17:76227550-76227572 GAGGTTAAATAATCTGTCCAAGG + Intronic
1152110623 17:78355822-78355844 GAGGTTAAGCAACCTGGCCAAGG - Intergenic
1152580002 17:81161697-81161719 GAAGTTATGAGACCTGTCCATGG + Intronic
1153048143 18:875407-875429 CAGGTTAGAAACCTTGTACAAGG + Intergenic
1153299261 18:3578755-3578777 GAGGTTGGAAAACTTGCCCAAGG - Intronic
1153619169 18:6960814-6960836 GAGCCTAGTAAACCTGACCAAGG - Intronic
1153693928 18:7621186-7621208 GAGGTTAAGAAACTTGCCCAAGG + Intronic
1153753371 18:8256321-8256343 GAGGTTAGATAACTTGCCGAAGG - Intronic
1154436631 18:14348323-14348345 GAGGTCAGAAAAGTTGCCCAGGG + Intergenic
1154934653 18:21040631-21040653 TGGATTAGAAAACCTCTCCATGG + Intronic
1155208150 18:23578280-23578302 GAGGCTAAACAACTTGTCCAAGG + Intronic
1155239483 18:23851798-23851820 GAGCTTAGGGAACTTGTCCAAGG - Intronic
1157141346 18:45110290-45110312 GAGGTTAGATAATGTGGCCAGGG + Intergenic
1157302518 18:46489234-46489256 GAGGACAGATAACTTGTCCAGGG - Intronic
1157499710 18:48180972-48180994 GAGGTTAAGTAACTTGTCCAAGG - Intronic
1157564367 18:48670017-48670039 GAGGTTAAACAACTTGTACAGGG + Intronic
1157676136 18:49569927-49569949 GAGGTGAGACAACTTGCCCAGGG + Intronic
1157798249 18:50596199-50596221 GAGGTTAAATGACTTGTCCAAGG + Intronic
1158118372 18:54022430-54022452 GAAGTTAAACAACCTGTTCATGG - Intergenic
1158132415 18:54167363-54167385 GAGGTTATAGACCTTGTCCAAGG - Intronic
1158143518 18:54283554-54283576 AAGGTTAAATAACTTGTCCAAGG + Intronic
1158249211 18:55467931-55467953 TGGGTTAGAAAACTTGCCCAAGG + Intronic
1158474732 18:57769954-57769976 GAGGTCAAGAAACTTGTCCATGG + Intronic
1158507535 18:58059993-58060015 GAGGTTAAATAACTTGCCCAGGG + Intronic
1159271701 18:66161493-66161515 GAGGTTAAACAACATGTCTAAGG + Intergenic
1159710421 18:71751276-71751298 GAGGGTAGAAAGTCTCTCCAAGG + Intronic
1161304595 19:3560006-3560028 GAGGTTAAAAGACTTGTCCCAGG - Intronic
1161602854 19:5195423-5195445 GAGGTTAAATAACTTGCCCAAGG - Intronic
1161846637 19:6714936-6714958 GAGGTTAGGTAACTTGCCCAGGG - Intronic
1162331317 19:10031484-10031506 AAGGGTTGAAAACCTGGCCATGG - Intergenic
1162335968 19:10060662-10060684 AAGGTTATAAAACCTTCCCATGG + Intergenic
1162831531 19:13287480-13287502 GAGTTGTGGAAACCTGTCCATGG - Intronic
1163356401 19:16814478-16814500 GAGGTTAGGAGACTTGCCCAAGG + Intronic
1163503506 19:17689633-17689655 GAGGTCACAAGACCTGCCCAAGG - Intergenic
1164437264 19:28241507-28241529 AAGGTTAGATAACTTGCCCAAGG + Intergenic
1164489251 19:28691639-28691661 GAGGTTAGAAAAAGTGTGGAGGG + Intergenic
1164567374 19:29336963-29336985 GAGGTTAAGAAACTTGTCCAAGG - Intergenic
1164833973 19:31345246-31345268 CAGAGTAGAATACCTGTCCAAGG + Intronic
1165779014 19:38421321-38421343 GAGGTTAGGTTGCCTGTCCAAGG - Intronic
925309011 2:2868763-2868785 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
925976456 2:9145530-9145552 GAGGCTAGATAACTTGCCCAAGG - Intergenic
926048564 2:9728264-9728286 GAGGTTAGGCAACTTGTCCATGG + Intergenic
926463296 2:13160774-13160796 GAGGATAAATGACCTGTCCAAGG + Intergenic
926927331 2:18000960-18000982 CAGGTTAGGAACCCTGTGCAGGG - Intronic
927140683 2:20128928-20128950 GAGGGTAGGAAACCTGGCCCAGG + Intergenic
927498296 2:23564972-23564994 GAGGTTAGGTAACCTGTCCAGGG - Intronic
927784086 2:25960402-25960424 GAGGTTATATAACCCATCCAAGG + Intronic
927855804 2:26527326-26527348 GAGGTTATGTAACCTTTCCAGGG + Intronic
927870982 2:26623617-26623639 GAGGTTTGGAAACCTGCCCAAGG - Intronic
927882484 2:26698405-26698427 GAGATTAGATAATGTGTCCAAGG - Intronic
928110933 2:28508221-28508243 GAGGCTAGCAAACCTGCCAAAGG - Intronic
928118617 2:28565732-28565754 GAGGTTAGGGAACTTGCCCAAGG - Intronic
928214600 2:29350798-29350820 GAGGTTAAGCAACTTGTCCAAGG + Intronic
928401729 2:30983959-30983981 GAGGTTAGGGGACTTGTCCAGGG - Intronic
929379169 2:41329677-41329699 GAGGCTAGATAACTTGCCCAAGG + Intergenic
929750108 2:44702551-44702573 CAGGTTAAGTAACCTGTCCAAGG + Intronic
929758681 2:44788513-44788535 GAGGTGAGACAACCTACCCAAGG + Intergenic
929835716 2:45396149-45396171 GAGTTTAAATAACTTGTCCAAGG + Intronic
929988895 2:46767513-46767535 GGGGTTAGATAACTTGTCTAAGG + Intergenic
930358967 2:50354384-50354406 GAGCTTAAATAACCTGCCCAAGG - Intronic
930539119 2:52681678-52681700 GAGCTTAGGATACCTGTCCTTGG - Intergenic
930641518 2:53859276-53859298 GAGGTTAGATAACTTCCCCAAGG + Intronic
931874609 2:66498352-66498374 GAGGTTAAATAACTTGCCCAGGG + Intronic
932039777 2:68286830-68286852 GAGGTTAGGCTACCTGCCCAAGG - Intronic
932119699 2:69087386-69087408 GAGGTTATGGAACCTGCCCAAGG + Intronic
932414553 2:71565717-71565739 GAGGTTAAGCAACCTGCCCAAGG - Intronic
933090012 2:78107614-78107636 GGGAATAGAAAACCTGGCCATGG - Intergenic
933114286 2:78447186-78447208 GAGTCTAGGAAATCTGTCCATGG + Intergenic
933427489 2:82131217-82131239 TAGGTCAGAAACCCTGTACAGGG - Intergenic
933432113 2:82195944-82195966 GAGCATTAAAAACCTGTCCAGGG - Intergenic
933611635 2:84442827-84442849 GAGGTTAGAGATCTTGCCCATGG - Intronic
933802614 2:85975158-85975180 GAGATTAAATAACTTGTCCAAGG - Intergenic
934048291 2:88189979-88190001 GAGGTTAGGTAACTTGTCCAAGG + Intergenic
934489359 2:94749185-94749207 GAGGTCAGAAAAGTTGCCCAGGG - Intergenic
934529802 2:95077757-95077779 AAGGTTAACAAACCAGTCCAAGG - Intergenic
934988005 2:98901126-98901148 GGGGTTGCAGAACCTGTCCAAGG - Intronic
935377325 2:102412775-102412797 CAGGTTAGGAATCCTGTGCAGGG - Intergenic
935398258 2:102633245-102633267 GAGCTTAGGTAACTTGTCCAAGG + Intronic
935703840 2:105839181-105839203 GAGTTTGGAAAAACTGCCCAGGG + Intronic
936351470 2:111716060-111716082 GAGGTTAAGAAACCTGTCCATGG + Intergenic
937054735 2:118924655-118924677 GAAGTTAGGTAACTTGTCCACGG - Intergenic
937232103 2:120404261-120404283 GAGGTTAAAAAACCTGTCTAGGG + Intergenic
937492731 2:122386834-122386856 GAGGTTAAATAACTTGTCCAAGG + Intergenic
937566677 2:123299799-123299821 TAGGTTAGAACACCTCTTCAAGG - Intergenic
938590831 2:132734732-132734754 GAGGTTAAGCAACTTGTCCAAGG + Intronic
938664327 2:133518687-133518709 GAGGTTAAATGACTTGTCCAAGG - Intronic
939215405 2:139231276-139231298 GAAGTTACATAACCAGTCCAAGG + Intergenic
939531350 2:143365699-143365721 GATGTTAAAAAACTTGTCTAAGG - Intronic
940005314 2:149004828-149004850 AAGGTTAGATAACTTGCCCAGGG + Intronic
940294817 2:152111438-152111460 GAGGTTAGAAAAGCTGCCAACGG + Intergenic
940823692 2:158386242-158386264 GAGGTTAAACAACTTGTTCAAGG + Intronic
941030629 2:160507740-160507762 GAGGTTAGGTAACTTGTCCAGGG - Intergenic
941198013 2:162474167-162474189 GAGGTTAGCAAACTTTCCCAGGG + Intronic
941199877 2:162495291-162495313 CAGGTTAGGAACCCTGTACAGGG - Intronic
941248207 2:163127239-163127261 AAGGTTAAATAACCTGGCCAAGG - Intergenic
941274526 2:163474051-163474073 GGGGTTGGAAAACCTGTATAAGG + Intergenic
941465856 2:165826102-165826124 GAGTTTAGATAACTTGCCCAAGG - Intergenic
942171375 2:173292705-173292727 CAGGTTAGGAACCCTGTACAGGG + Intergenic
942324111 2:174761002-174761024 GAGGTTGGACCACTTGTCCAAGG + Intronic
942366653 2:175235428-175235450 GAGGTTAGGTAACTTGTCTAAGG + Intergenic
942505863 2:176640932-176640954 GAGGTTATATAACTTGTCCAGGG - Intergenic
942547893 2:177083723-177083745 GAGGTTAAATAACTTGTTCAGGG + Intergenic
942657945 2:178233724-178233746 GAGATTAAATAGCCTGTCCATGG - Intronic
943466816 2:188238789-188238811 CAGGTCAGAAACCCTGTACAGGG - Intergenic
943590553 2:189791233-189791255 GAAATTAGAAAACTTGTCCAAGG - Intronic
943692574 2:190882771-190882793 GATATTAAATAACCTGTCCATGG - Intronic
944230454 2:197386905-197386927 AAGGTTAAAAAACTTGCCCAAGG + Intergenic
944235232 2:197436242-197436264 GAGCTTAGATAACCTGTCCCTGG + Intergenic
944692733 2:202172258-202172280 GAGGTTAGGTAACTTGCCCAAGG + Intronic
944844061 2:203651420-203651442 GAGGTTAAGAAACTTGCCCAAGG + Intergenic
945180856 2:207089679-207089701 GAGGTTTGTTAACCTGCCCAAGG - Intronic
945214027 2:207414230-207414252 GAGATTAAAAAACTTGCCCAAGG + Intergenic
945406520 2:209455276-209455298 GATGATAGATAATCTGTCCAAGG + Intronic
945415137 2:209561478-209561500 GAGGTTAAATAACTTCTCCAAGG - Intronic
945584402 2:211640545-211640567 TAGGTTATACAACTTGTCCAAGG + Intronic
946010013 2:216557178-216557200 GAGGTTAAATAACCTGCCCAGGG + Intronic
946168048 2:217877403-217877425 GAGGTTAGCAATCTTGTCCAGGG - Intronic
946367760 2:219260577-219260599 GAGGGTAGAAAACAGTTCCATGG - Intronic
946390200 2:219410488-219410510 GCTGTTAGAAAACCTTTCCTTGG - Intergenic
946403005 2:219478427-219478449 GAGGTTAAATAACTTGCCCAAGG + Intronic
947082437 2:226413482-226413504 GAGGTTAAACAACTTGCCCAAGG + Intergenic
947392803 2:229656315-229656337 GAGGTCAAGAAACATGTCCAAGG - Intronic
947753317 2:232543961-232543983 GAGGTTAAGTAACCTGCCCAAGG + Intronic
948295029 2:236854250-236854272 GAGGTTAAGCAACTTGTCCAAGG + Intergenic
948773966 2:240270466-240270488 GAGGTTGGAAACCCTGTGCAGGG + Intergenic
949086336 2:242158956-242158978 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1168793819 20:597871-597893 GAGGTTAAAGAACTTGGCCAAGG - Intergenic
1168840600 20:907663-907685 GAGGTTAAACAACTTGTCCAAGG + Intronic
1169719122 20:8653864-8653886 GAGGTTACAAAACTTGTCTAAGG - Intronic
1170085995 20:12532298-12532320 AAGGTTAAATAACTTGTCCAAGG - Intergenic
1171441244 20:25164929-25164951 CAGGTTGGAAACCCTGTACAGGG + Intergenic
1172155444 20:32820474-32820496 GCGGTTAAAGCACCTGTCCAAGG - Intronic
1172249748 20:33470691-33470713 GAGGTTAGTGAACTTGCCCAAGG + Intergenic
1172371223 20:34393781-34393803 TAGGTTGGAAAACCTGAACATGG - Exonic
1172429948 20:34881736-34881758 GAGGTTAAATAACTTGTCTAAGG - Intronic
1172597672 20:36161282-36161304 GAAGGTAGAAAGCTTGTCCAAGG - Intronic
1172597786 20:36162121-36162143 GAGGTTAAGTAACCTGCCCAAGG + Intronic
1172995187 20:39065068-39065090 GAGGTTAGGTAACCTACCCAGGG - Intergenic
1173202195 20:40962321-40962343 GATGTTAAATGACCTGTCCAAGG + Intergenic
1173460834 20:43242282-43242304 GAAGTTGGATAACCTGCCCAAGG + Intergenic
1173839359 20:46147198-46147220 GAGGTGAGATAACTTGCCCAAGG - Intergenic
1173957307 20:47043611-47043633 GAGGTTAAGAAACTTGTCCAAGG - Intronic
1173990523 20:47299275-47299297 GAGGTTAAGAGACTTGTCCAAGG - Intronic
1174160130 20:48544602-48544624 GAGGTTAAGTAACCTGCCCAAGG - Intergenic
1174273854 20:49389236-49389258 GAGGTTAAGAAACTTGTCCGAGG - Intronic
1174344014 20:49916127-49916149 GAGGTTAGGTAACTTGTCCAAGG - Intergenic
1174345259 20:49924366-49924388 GAGGTTAGATAGCTTGTCCAAGG - Intergenic
1174437572 20:50521624-50521646 GAGGTTAGAAAACTAGGCAAAGG - Intronic
1174634898 20:51990534-51990556 GAGGTTAGATGGCCTGCCCAAGG - Intergenic
1174904121 20:54532245-54532267 GAGGTTAAACAACCTGCCCAAGG + Intronic
1175049725 20:56143606-56143628 GAGGTTAAGTAAACTGTCCAAGG + Intergenic
1175411983 20:58776453-58776475 GAGGTGGGATGACCTGTCCAAGG - Intergenic
1175467189 20:59197395-59197417 GAGCTTAGATAACCTACCCAAGG + Intronic
1175546404 20:59780792-59780814 GAGGTTAAGAAACTTTTCCAAGG - Intronic
1175581535 20:60103669-60103691 GAGGTTTAAAAGCCTGTCCCAGG + Intergenic
1175958588 20:62623769-62623791 GAGGCCAGGAAAGCTGTCCAAGG - Intergenic
1176030627 20:63009531-63009553 GAGGTTCGAGAAGCTGGCCAAGG - Intergenic
1176840414 21:13837332-13837354 GAGGTCAGAAAAGTTGCCCAGGG - Intergenic
1176916421 21:14631372-14631394 GAGTTTAAAGAACTTGTCCAAGG + Intronic
1177157225 21:17512567-17512589 GAGGTCAGAGAACCTGCCCCTGG + Exonic
1177420892 21:20854969-20854991 GAGGTTAATTAACCTGTCCATGG - Intergenic
1177759687 21:25389309-25389331 GAGATTAGGTAACTTGTCCAAGG - Intergenic
1177919458 21:27132740-27132762 AAGGTTAAATAACTTGTCCAAGG - Intergenic
1177995054 21:28086818-28086840 GAAGTTAAAAAACCTCTACAAGG - Intergenic
1178180756 21:30158504-30158526 GAGGTTATATAACCTTTCCAGGG - Intergenic
1178462074 21:32811470-32811492 GAGGTTAAATAACTTGTCCAAGG + Intronic
1178465970 21:32847919-32847941 GAGGTTAAGAGACCTGCCCATGG + Intergenic
1178709815 21:34906551-34906573 GAAGTTAGACAACTTGCCCAAGG + Intronic
1178884133 21:36472130-36472152 AAGGTTACATAACTTGTCCAAGG + Intronic
1178895303 21:36552921-36552943 CAGGTTAAAACACATGTCCAAGG - Intronic
1178916935 21:36710162-36710184 GAGGTTAAATAACATGTCTAAGG + Intronic
1179162335 21:38908877-38908899 GAGGTTAGGAAACTTGTCCAAGG + Intergenic
1180743802 22:18072955-18072977 GAGGTTAAATAACTTGTCCAAGG - Intergenic
1181446610 22:22981104-22981126 CAGGTCAGAAACCCTGTACATGG - Intergenic
1181457024 22:23065605-23065627 GAGGTTAAGTAACTTGTCCAAGG - Intronic
1181770801 22:25123975-25123997 GAGGTGGGAAGACCTGCCCATGG + Intronic
1181792538 22:25278824-25278846 GAGATTAGACAACTTGTCTAAGG + Intergenic
1181813077 22:25416449-25416471 GAGATTAGACAACTTGTCTAAGG + Intergenic
1181831056 22:25560641-25560663 GAGATTAGACAACTTGTCTAAGG + Intergenic
1181882975 22:25996144-25996166 GAGGTTGAATAACTTGTCCAAGG - Intronic
1182013154 22:27017273-27017295 GAGGTTAGCTAACTTGTCCAGGG - Intergenic
1182088142 22:27575570-27575592 GAGGTTAAGAAACATGCCCAAGG + Intergenic
1182218617 22:28740461-28740483 GTGGTTATCAAACCAGTCCAAGG - Intronic
1182227793 22:28813089-28813111 GAGGTTAAGCAACTTGTCCAAGG - Intergenic
1182239779 22:28906492-28906514 GAGGTTGGATGACCTGGCCAAGG - Intronic
1182473262 22:30561489-30561511 GAGGTGACATAACTTGTCCAGGG + Intronic
1182540753 22:31040036-31040058 GAGGTTGGATAACTTGCCCACGG - Intergenic
1182751937 22:32648646-32648668 GAGGTTAATCAACCTGCCCATGG - Intronic
1182769188 22:32781448-32781470 GAGGTTAGGTAACTCGTCCAAGG - Intronic
1182861897 22:33567544-33567566 AAGCTGAGCAAACCTGTCCAAGG - Intronic
1183099685 22:35576179-35576201 GTGGTTAGCTAACCTGCCCAAGG + Intergenic
1183288827 22:36985217-36985239 GGGGTTAGGTGACCTGTCCAGGG - Intergenic
1183711070 22:39503720-39503742 GAGGTTAGGAGACTTGCCCACGG + Intronic
1183788149 22:40043941-40043963 GAGCTTAGAAAACTTGCCCAAGG - Intergenic
1184043219 22:41956749-41956771 GAGGTTAGGCAACTTGCCCAAGG + Intergenic
1184368911 22:44070199-44070221 GAGGTTAAGTAACCTGCCCAAGG + Intronic
1184414170 22:44342525-44342547 GAGGTTAAGTACCCTGTCCAGGG + Intergenic
1184445421 22:44544310-44544332 GAGGTTAAGTAACTTGTCCAGGG + Intergenic
1184467569 22:44677753-44677775 GAGGTGAAGCAACCTGTCCAAGG - Intronic
1184535426 22:45083361-45083383 GAGGTTAAAGAACCTGTCTTTGG + Intergenic
1184675267 22:46038285-46038307 GAGGTTAAGAAACTTGCCCAAGG - Intergenic
1184917800 22:47584507-47584529 CAGGTTAGGAACCCTGTACAGGG - Intergenic
949801849 3:7912804-7912826 CAGGTTAAAAAACTTGTTCAAGG - Intergenic
950165526 3:10794499-10794521 GAGGTTAAGAAACTTGTCCAGGG - Intergenic
950180788 3:10911775-10911797 GAGGTTAAGTAACTTGTCCAGGG + Intronic
950222269 3:11205438-11205460 GAAGTTAAAAAACTTGCCCAAGG - Intronic
950448260 3:13050645-13050667 GAGGTTAGTTAACTTGCCCAAGG - Intronic
950701975 3:14757207-14757229 GAGGTTAGGGGACCTGTTCAAGG + Intronic
951106329 3:18747568-18747590 GAGGTTAGGCAACTTGCCCAAGG + Intergenic
951251654 3:20400972-20400994 GAGGTTAAGAACCCTGCCCAAGG - Intergenic
951520384 3:23605709-23605731 GAAGTTAGAAAGCCTGGCCTGGG + Intergenic
951823522 3:26841722-26841744 GAGGTTAAATTTCCTGTCCATGG + Intergenic
951985083 3:28610614-28610636 GAAGTTAAATAACCTGCCCAAGG + Intergenic
952443455 3:33357019-33357041 GAGGTTAAGTAACCTGCCCAGGG - Intronic
953414301 3:42706883-42706905 GAGGTTAAATAACTTGCCCAAGG + Intronic
953685557 3:45075864-45075886 GAGGTTAAACAACCTGTCTGGGG - Intergenic
953735875 3:45493531-45493553 GAGGTTAAGAACCTTGTCCAAGG - Intronic
953820623 3:46204769-46204791 GTGGTTAGGAAACATGTTCAAGG + Intronic
954398963 3:50309639-50309661 CAGGTAAGAAATCCTGTACAGGG - Intronic
954851330 3:53603367-53603389 GAGGTTACAAAACTTGCCCAAGG - Intronic
955340383 3:58120860-58120882 GAGGTTAAGTAACTTGTCCAGGG - Intronic
955376302 3:58400105-58400127 GAGGTTAGGAAATTTGTCTAAGG - Intronic
955381039 3:58438348-58438370 CAGGTCAGAAATCCTGTACAAGG + Intergenic
955412388 3:58664114-58664136 GAGGTGAGGTAACCTGCCCAAGG - Intronic
955676591 3:61455388-61455410 GAGGTAAAAAGACTTGTCCAAGG + Intergenic
955828212 3:62971939-62971961 GGGTTTAGACAACCTGGCCAAGG + Intergenic
955865984 3:63384832-63384854 GATGTTACATAACTTGTCCAAGG + Intronic
956567419 3:70654650-70654672 GAGGTTAGATAACTTGCCCAAGG + Intergenic
956789045 3:72666583-72666605 GAGGTTAAATGACTTGTCCAAGG - Intergenic
959086332 3:101854234-101854256 GAGGTTAAATAACTTGCCCAAGG - Intronic
959552943 3:107684404-107684426 GAGGTAATAAGCCCTGTCCAAGG + Intronic
959681516 3:109101812-109101834 GAGTTTTAAAAACCTGCCCAAGG + Intronic
959906566 3:111717137-111717159 GACCTCAGAAAACTTGTCCACGG - Intronic
960193991 3:114742609-114742631 GAGATTAAATAACTTGTCCAAGG + Intronic
960514961 3:118593472-118593494 CAGGTTAGAAACCCTGTACGGGG - Intergenic
960864997 3:122190485-122190507 GAGGTTGGACAACCTGCCCAAGG - Intronic
961078627 3:124005048-124005070 GAGGTTAGGAGTCCTGGCCAGGG + Intergenic
961222022 3:125208607-125208629 GAGGTTACGAAACTTGTTCAAGG + Intronic
961915396 3:130368934-130368956 GAGGTCACAGAACCAGTCCATGG - Intronic
962189821 3:133298716-133298738 GAGGTTAGGCTACCTGCCCAAGG + Intronic
962301092 3:134243746-134243768 GAGTTTAGGAAACTTGTCCCAGG - Intronic
962722218 3:138186848-138186870 AAGGTTAGATAACTTGCCCAGGG + Intergenic
963038737 3:141053074-141053096 GAGGTTAGAGAACTTGCCCAAGG - Intronic
963262603 3:143207827-143207849 GAGGTTAAGTAACTTGTCCAAGG - Intergenic
963738061 3:149043790-149043812 TAGGTTAAGCAACCTGTCCAAGG - Intronic
963768803 3:149367500-149367522 GAGGTTAAGTAATCTGTCCAAGG - Intergenic
963855677 3:150250742-150250764 GAGGTTAAGAAATTTGTCCAAGG - Intergenic
964121844 3:153193467-153193489 GAGGTTAAATAACTTGCCCAAGG + Intergenic
965638491 3:170808697-170808719 GAGGTTAAATAACTTGCCCAAGG - Intronic
965912089 3:173790863-173790885 GAGATTAGAAAACATGTCAAAGG + Intronic
966465879 3:180230946-180230968 CAGGTTAGAAAACCTGTACAGGG - Intergenic
966547642 3:181169028-181169050 GAGGTTAGGAAAGTTGTCCAAGG + Intergenic
966571633 3:181450520-181450542 GAGGTTTAGAAACTTGTCCAAGG + Intergenic
966966227 3:184997308-184997330 GAGGTTAAATAACTTGTCCAAGG - Intronic
966984723 3:185168720-185168742 GAGGTTAAGGAACTTGTCCAAGG + Intergenic
967088340 3:186113881-186113903 GAGGTTAGGTAACTTGCCCAAGG + Intronic
967466282 3:189809819-189809841 GAAGTTATAAAACTTGTCCTGGG - Intronic
967548281 3:190758680-190758702 GATGTTAGAATCCCTGTCCTGGG - Intergenic
967599525 3:191369019-191369041 GAGGCTAGAAAAACAGTCTAAGG - Intronic
967775085 3:193377911-193377933 GAGGTTAAATAACTTGCCCAAGG - Intronic
969087677 4:4668558-4668580 GAGGTTAAATAACCTGTCCAAGG - Intergenic
969178849 4:5421868-5421890 GAGGTTAATTAACCTGCCCAGGG + Intronic
969194433 4:5549358-5549380 GAGGTTGAAGAACTTGTCCAGGG + Intronic
969260302 4:6029153-6029175 TAGATTAGGACACCTGTCCATGG - Intronic
969261082 4:6034288-6034310 GAGGTTAAATAATTTGTCCAAGG + Intronic
969303404 4:6310583-6310605 GAGGTTAGGGAACCTGCCCAGGG - Intergenic
969428234 4:7138291-7138313 GAGGCTAAGAAACTTGTCCAAGG - Intergenic
969458803 4:7316554-7316576 AAGGTCAGATAACTTGTCCAGGG - Intronic
969608793 4:8215858-8215880 GAGGTCAGATAACTTGACCACGG + Intronic
970052551 4:11931134-11931156 AAAGTTAGAAAACCTGTTCTTGG - Intergenic
970231708 4:13917497-13917519 GAGATTAAATAACTTGTCCAAGG - Intergenic
970446224 4:16125282-16125304 GAGTTTAAGAAACCAGTCCAGGG - Intergenic
970491133 4:16574863-16574885 GAGCTTAGGAAACTTGTTCAAGG + Intronic
970498258 4:16650172-16650194 GAGGTTAGAAAATTTGCTCAAGG - Intronic
971068501 4:23062868-23062890 GAGATTAAATAACATGTCCAGGG + Intergenic
971110000 4:23574134-23574156 CAGGTTAGGAATCCTGTACAGGG + Intergenic
971418857 4:26457339-26457361 GAGGTTAGGTAACCTGTCCAAGG - Intergenic
972428522 4:38958251-38958273 GAGGTTAAGAAACTTGTTCAAGG - Intergenic
972658632 4:41091879-41091901 GTGGTTAGAAAACTTGCTCAAGG - Intronic
972853451 4:43077131-43077153 CAGGTGAGAAACCCTGTACAGGG + Intergenic
973604661 4:52574664-52574686 GAAGTTAAATAACTTGTCCAAGG + Intergenic
973614609 4:52665929-52665951 GAGGTTAAGAAACTTGCCCAAGG - Intergenic
973725895 4:53775344-53775366 GATGTGATACAACCTGTCCAAGG - Intronic
973753570 4:54048618-54048640 GAGGTTAGGAAACGTGCCTAAGG + Intronic
974047775 4:56911664-56911686 GAGGTTAAACAACTTGTGCAAGG - Intronic
974295693 4:59995820-59995842 CAGATTAGAAACCCTGTACAGGG + Intergenic
975350939 4:73345571-73345593 GAGGTTAGGTAACTTATCCAAGG - Intergenic
975400422 4:73930803-73930825 AAGGTTATAAAACCTGTTAATGG - Intergenic
976375315 4:84339210-84339232 GAAGTTGGGAAACCTGTACAAGG - Intergenic
976472178 4:85441913-85441935 GAGATTAAGAAACTTGTCCATGG - Intergenic
976541843 4:86286583-86286605 GAAGTGAGGAAACTTGTCCAAGG + Intronic
976643869 4:87367303-87367325 TAGGTCAGAAACCCTGTACAGGG - Intronic
976659943 4:87530192-87530214 GAGGTTATATAACTTGTCCCGGG - Intronic
976776355 4:88710470-88710492 TAGGTTAAGAAACCTGCCCAAGG - Intergenic
977864626 4:102009643-102009665 GGGGTTAAATAACTTGTCCAAGG - Intronic
978019679 4:103792198-103792220 CAGGTTAGGAACCCTGTGCAGGG - Intergenic
978032490 4:103952426-103952448 CAGGTCAGAAAACCTGTACAGGG - Intergenic
978711840 4:111791724-111791746 GAGGTTAAATAACATGTACAAGG - Intergenic
978726736 4:111977855-111977877 GGGGTTTGAAAACCTGCCCCAGG + Intergenic
979109469 4:116733762-116733784 AGGGTTAGCAAACCAGTCCAGGG - Intergenic
979164720 4:117514363-117514385 GAGGTTAAGTTACCTGTCCAAGG - Intergenic
979238058 4:118423935-118423957 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
979319997 4:119312077-119312099 GAGGTTATATAACTTGCCCAAGG - Intergenic
979645700 4:123065340-123065362 GAGGTTAAGGAACCTGTCCTAGG - Intronic
979753722 4:124312754-124312776 GAGGGTAGAAAACCTGAATAGGG - Intergenic
979818227 4:125137486-125137508 GAGGTTAGAAACACTGTTCATGG - Intergenic
980207376 4:129737602-129737624 GAGGTTATATAACCTACCCAAGG + Intergenic
980642789 4:135601498-135601520 CAGGTTAGGAACCCTGTGCAGGG - Intergenic
980950443 4:139370703-139370725 GAGGTTAGACAAAGTGTCCAAGG - Intronic
981292743 4:143095554-143095576 CAGGTCAGAAACCCTGTACAGGG - Intergenic
981431517 4:144666825-144666847 GAGGTTAAACAACTTGCCCAAGG - Intronic
981564918 4:146090188-146090210 GAGGTTAGGTAACTTGCCCAAGG - Intergenic
981591554 4:146369221-146369243 GAGGTTAGATAACATGTTTAGGG - Intronic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
982032937 4:151318776-151318798 GAGGTTACGTAACTTGTCCAAGG + Intronic
982314060 4:154013247-154013269 GATGTTAGGTAACTTGTCCAAGG + Intergenic
982475811 4:155849202-155849224 CAGGTCAGAAACCCTGTACAGGG - Intronic
982606667 4:157524513-157524535 CAGGTTAGGAAACCTGTACAGGG + Intergenic
982664551 4:158245466-158245488 GAGGTTAAGAAACTTGGCCAAGG - Intronic
982680190 4:158419284-158419306 CAGGTTTGAAAACCTGCCCCTGG + Intronic
982803338 4:159731839-159731861 GAGGTTAAATAACTTGTCCAGGG + Intergenic
983091873 4:163513592-163513614 GATGTTAAATGACCTGTCCAGGG - Intronic
983118381 4:163849205-163849227 GAAATTTAAAAACCTGTCCAAGG - Intronic
983915163 4:173283678-173283700 CAGGTTAGGAACCCTGTACAGGG + Intronic
984441540 4:179777173-179777195 CAGGTCAGAAACCCTGTACAGGG - Intergenic
984539055 4:181014300-181014322 GAGTTTAAACAACTTGTCCAAGG - Intergenic
984650685 4:182267508-182267530 CAGGCTAGAAACCCTGTACAGGG - Intronic
984655201 4:182310024-182310046 GAGCTTAAGTAACCTGTCCAAGG + Intronic
986224614 5:5801222-5801244 GGGGAAAGAAAACCTGACCAAGG - Intergenic
986296799 5:6446229-6446251 GAGGTGAGAAAACGTCTCCTGGG - Intergenic
986627620 5:9737348-9737370 GAAGTTAAATAACTTGTCCAAGG - Intergenic
987417258 5:17676001-17676023 GAGGTTAGAAAGATTCTCCAAGG - Intergenic
987462847 5:18234401-18234423 GAGGTTATAAAGCCTCTCTAGGG + Intergenic
988437349 5:31192033-31192055 GAAGTTACATAACATGTCCAAGG - Intergenic
988993622 5:36693953-36693975 GAGGTTAAGAAACTTGCCCAAGG - Intergenic
989281934 5:39654665-39654687 CAGGTTAGGAACCCTGTGCAGGG - Intergenic
990020858 5:51125713-51125735 GAGGTTAAATAACTTGTCCAAGG - Intergenic
990235419 5:53762113-53762135 GAGGTTAATAAACTTGCCCAAGG + Intergenic
990481522 5:56215707-56215729 GAGGTTACATAACTTGCCCAAGG - Intronic
991614117 5:68478333-68478355 GAGGTTAAATAACTTGTTCAGGG + Intergenic
991979185 5:72214018-72214040 GACGTTAGAAACCCTGGCCTAGG - Intergenic
992365962 5:76089799-76089821 GAGGTTAAGAAACTTGTTCATGG - Intronic
992663253 5:78982587-78982609 GAGGTTAAGAAACTTGCCCAAGG - Intronic
992707879 5:79415888-79415910 GAGGTTAGGTAACTTGCCCAAGG - Intronic
992946280 5:81813942-81813964 GAGGTTAAAAAATTTGTCCTAGG - Intergenic
993120818 5:83772223-83772245 CAGGTCAGAAACCCTGTACAGGG - Intergenic
993458228 5:88149729-88149751 GAGGTTAGGTAACTTGTCCCAGG - Intergenic
993721668 5:91327018-91327040 GAGATTACAAAATCTGCCCAAGG + Intergenic
993939666 5:94043637-94043659 CAGGTCAGAAACCCTGTACAGGG - Intronic
994759447 5:103834742-103834764 GAGGTTAAACAACTTGTCCATGG + Intergenic
995007641 5:107219466-107219488 GAGGTTAAATAACTTTTCCAAGG - Intergenic
995320572 5:110829357-110829379 CAGGTTAGGAACCCTGTACAGGG - Intergenic
995651444 5:114373544-114373566 GAGATTAAGTAACCTGTCCAAGG - Intronic
995876576 5:116796573-116796595 GAGGTTCCAAAACATGTCCATGG + Intergenic
996466889 5:123813241-123813263 GAGATTAGAAAACCTAACCAAGG - Intergenic
996607952 5:125346009-125346031 GAGGTTAGGCAACTTGCCCAGGG + Intergenic
997297143 5:132775522-132775544 GGGGTTAAATAACCTGCCCAAGG + Intronic
997436976 5:133882585-133882607 AAGTTTAGAAAACCTGTCCAGGG - Intergenic
997803525 5:136890499-136890521 GAGGTTAAATAACTTGCCCAAGG - Intergenic
998077080 5:139245695-139245717 GAGGTTAAGTAACTTGTCCAAGG - Intronic
998371717 5:141666222-141666244 GAGGTTAAATAACTTGTCCAGGG + Intronic
998822592 5:146070159-146070181 GAGGTCAAATGACCTGTCCAAGG + Intronic
998876333 5:146603825-146603847 GAGGTTTTATAACCAGTCCAGGG + Intronic
998901327 5:146858160-146858182 GAGGTTAAATAACTTGCCCAAGG + Intronic
998930493 5:147176026-147176048 GAAGTTAAACAACCTGCCCAAGG - Intergenic
999085878 5:148889099-148889121 GATGTTAGAAAACATGGTCAAGG - Intergenic
999127394 5:149255983-149256005 GGGGTTAGGTAACTTGTCCATGG + Intronic
999197132 5:149790040-149790062 GAGGTTAGGCAACTTGCCCAAGG - Intronic
999207132 5:149857122-149857144 GAGGTTAGAAAACCTGCCCGAGG - Intergenic
999494992 5:152088095-152088117 GAGGTTCGATCACCTGCCCAGGG - Intergenic
999903841 5:156117688-156117710 GAGGTTAAATAACATGCCCAAGG + Intronic
1000061241 5:157657987-157658009 CAGGTCAGAAACCCTGTACAGGG - Intronic
1000179426 5:158793629-158793651 GAGGTTAAAAAGCTTGCCCAAGG - Intronic
1000210883 5:159105122-159105144 GAAGTTGAAAAACTTGTCCACGG + Intergenic
1000288878 5:159851182-159851204 GACGTTAATAAACCTCTCCACGG + Intergenic
1000330279 5:160200129-160200151 GAGGTTAGGAAGGCTGTCTAAGG - Intronic
1000942053 5:167373765-167373787 GAGGTTAAACACCATGTCCAAGG - Intronic
1000965544 5:167651741-167651763 GAGATTAGATAATTTGTCCAAGG - Intronic
1001143698 5:169166040-169166062 GAGGTTAAATAACTTGCCCAAGG + Intronic
1001933741 5:175690323-175690345 GAGGTTATCAAACCTGTAAATGG - Intergenic
1001945405 5:175773744-175773766 GAGGTTAATTCACCTGTCCAAGG - Intergenic
1001971036 5:175955141-175955163 GAGGTTAGAGAACTTGTCCAGGG - Intronic
1002246406 5:177888636-177888658 GAGGTTAGAGAACTTGTCCAGGG + Intergenic
1002246853 5:177891630-177891652 CAGGTTAGAGGACCTGGCCAAGG - Intergenic
1002327085 5:178416703-178416725 GAGATTAAATAACTTGTCCAAGG + Intronic
1002682475 5:180978079-180978101 CAGGTCAGAAACCCTGTACAGGG + Intergenic
1002738486 5:181415911-181415933 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1003895950 6:10607890-10607912 GAGATTAGATAACCTGTCAGTGG + Intronic
1004584991 6:16990560-16990582 CATGTTAGAAAACCTCTCCCTGG + Intergenic
1004645328 6:17554767-17554789 GAAGATAGAAAACCTCTCTAAGG - Intronic
1004742958 6:18480754-18480776 AAGGTTACATAACTTGTCCAAGG - Intergenic
1005339825 6:24833004-24833026 GAGGTTAAGTAACCTGCCCAAGG + Intronic
1006028129 6:31160306-31160328 GAGGTTAAGGAACTTGTCCAGGG + Intronic
1006440690 6:34051892-34051914 GAGGTGAGGTAACCTGCCCAAGG + Intronic
1006440902 6:34053189-34053211 GAAGTTAGATAACTTGTCCAAGG + Intronic
1006510904 6:34520522-34520544 GAAGTTAGATAACTTGTCCAAGG - Intronic
1006513262 6:34532909-34532931 GAGGTTAGGAAACCAGGCCAGGG - Exonic
1006561827 6:34919668-34919690 GAGGTTAAGAAACTTGCCCAAGG - Intronic
1006749517 6:36367796-36367818 GAGGTCAAGAAACTTGTCCAAGG - Intronic
1006901635 6:37506341-37506363 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1007521967 6:42456995-42457017 GAGGTTAAGAAACCTTACCAAGG - Intergenic
1007758748 6:44119060-44119082 GAGGTTAAATAACTTGCCCAAGG + Intronic
1007918360 6:45583913-45583935 GAGGTTAGTTGACCTGCCCAAGG - Intronic
1008397949 6:51031203-51031225 GAGGTTAAGTAACCTGCCCAGGG + Intergenic
1008468692 6:51858979-51859001 GTGGTCAGAAAACCTCTCCTAGG + Intronic
1008524337 6:52393143-52393165 GAGATTACATAACTTGTCCAAGG - Intronic
1008887560 6:56447505-56447527 GAGGTTAAATAAACTGCCCAAGG - Intergenic
1010007998 6:71016554-71016576 GAGGTTTAATAACCTGCCCAAGG - Intergenic
1010042755 6:71406081-71406103 AAGATAATAAAACCTGTCCAGGG - Intergenic
1010160266 6:72845988-72846010 GAGGTTAGGAAGCCTGTTCAGGG + Intronic
1010596006 6:77765096-77765118 GAGGTTAGTTAACTTGTCTAAGG - Intronic
1011487160 6:87854668-87854690 GAAGTGAAAAAACCTGTTCAAGG + Intergenic
1011563027 6:88642685-88642707 GAGGTTAAATAACTTGCCCATGG - Intronic
1011605037 6:89094862-89094884 GATGTTAGGTAACTTGTCCAAGG + Intergenic
1011780326 6:90782121-90782143 AAGGTTAGATAATCTGTCCAAGG + Intergenic
1012259570 6:97072021-97072043 GAGCTAAGACAAGCTGTCCATGG - Intronic
1012301787 6:97598419-97598441 GAGGTTAAGAAACTTGTCCAAGG - Intergenic
1012421328 6:99068880-99068902 GAGGTTAAGCAACCTGCCCAAGG + Intergenic
1012594810 6:101027130-101027152 CAGGTTAGGAACCCTGTACAAGG - Intergenic
1012936555 6:105373762-105373784 GAGGTTAGGAAGCTTGTCTAAGG - Intronic
1013178802 6:107700666-107700688 GAGGGCTGCAAACCTGTCCATGG - Intergenic
1013290610 6:108716052-108716074 GAGGTTACAAAACATGCCCAAGG - Intergenic
1013432949 6:110071819-110071841 GAGGTTAAGAAACTTGCCCAAGG + Intergenic
1013609500 6:111781036-111781058 AAGGTTAGGAAAACTGTCCAGGG - Intronic
1013876071 6:114830367-114830389 GAGGTTAAGCAACCTGTCCAAGG + Intergenic
1013988169 6:116221754-116221776 GAGGTTATAAAACCTGCCCCAGG - Intronic
1015166259 6:130203331-130203353 AAGGTTATATAACTTGTCCAAGG + Intronic
1015906367 6:138121464-138121486 GAAGTTAAACAACATGTCCAAGG + Intergenic
1017054106 6:150422815-150422837 GAGATGAAATAACCTGTCCAAGG + Intergenic
1017343629 6:153355338-153355360 TAGGTCAGAAACCCTGTACAGGG - Intergenic
1017351173 6:153443740-153443762 CAGGTCAGAAACCCTGTACAGGG + Intergenic
1017512009 6:155122760-155122782 CAGGTTAGAAAACCTTCACAGGG + Intronic
1017541390 6:155406649-155406671 CAGGGTAGATAACCTGTCCAAGG + Intronic
1017663349 6:156695376-156695398 GAGTTTAGGCAACCTGTTCAAGG - Intergenic
1018145897 6:160888391-160888413 CAGGTCAGAAATCCTGTACAGGG - Intergenic
1018441349 6:163816361-163816383 GAGGTTAAGAAACATGTCCAAGG - Intergenic
1019243589 6:170691463-170691485 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1019363701 7:619490-619512 GAGGTTAAGGAACCTGCCCAAGG + Intronic
1020340851 7:7109391-7109413 CAGGTCAGAAACCCTGTACAGGG - Intergenic
1020438939 7:8196901-8196923 GAGGAAAGAAAGCTTGTCCAGGG - Intronic
1020581992 7:10013556-10013578 GAGGTTATATAACCTGCCCTAGG + Intergenic
1020623655 7:10550141-10550163 GATGCTAGAAAACTTGCCCAAGG + Intergenic
1020893498 7:13909827-13909849 GAGGTTAAATAATGTGTCCAGGG - Intronic
1020971005 7:14938904-14938926 GAGGTTAGATCACATGACCAAGG - Intronic
1021207169 7:17796567-17796589 GAGGTTAAATAACCTATCCAAGG - Intronic
1021491554 7:21224770-21224792 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1021596959 7:22327654-22327676 GAAGTTAAATAACTTGTCCAAGG - Intronic
1022525103 7:31032115-31032137 GAGGTTAAGTAACCTGCCCAAGG + Intergenic
1022805402 7:33816130-33816152 GAGGTTACATAACTTGTCTAAGG - Intergenic
1023115662 7:36859636-36859658 GAGCTTAAGAAACGTGTCCAGGG - Intronic
1023186097 7:37534714-37534736 GAGGTTAAATCACTTGTCCAAGG + Intergenic
1023454888 7:40327952-40327974 GAGTTTAGATAACTTGTGCAGGG + Intronic
1023605310 7:41925938-41925960 GAGGTTAAGAAACTTGCCCAAGG - Intergenic
1024162048 7:46686800-46686822 GAAATTAGAAAACTTGTACATGG + Intronic
1024397858 7:48889831-48889853 CAGATGAGAAAACCTGCCCAGGG + Intergenic
1024398174 7:48893024-48893046 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1024520601 7:50302529-50302551 GAGTTTGGATAACCTGCCCAAGG + Intergenic
1024874789 7:54009382-54009404 GAGGTTGGGAAACTTGCCCAAGG - Intergenic
1024927329 7:54631166-54631188 TAGATTAGAAACCCTGTACAGGG - Intergenic
1025090040 7:56054658-56054680 AAGGTTCTATAACCTGTCCAAGG - Intronic
1025741352 7:64199141-64199163 CAGGTTAGGAACCCTGTACAGGG + Intronic
1026371169 7:69701072-69701094 GAGGTTAGGTAACTTGTCCGAGG - Intronic
1026374532 7:69737394-69737416 GAGGTTAGATAACTTGCTCAAGG + Intronic
1026683724 7:72490440-72490462 GAAGTTAGACAACATGGCCACGG - Intergenic
1027365641 7:77455109-77455131 GAGGTTAGGTTACTTGTCCAAGG - Intergenic
1027414462 7:77960177-77960199 GAGGTTAAGAAGCTTGTCCAAGG + Intergenic
1027414832 7:77963850-77963872 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1027508327 7:79046619-79046641 GAGTTTACAAAACTTGTTCAAGG + Intronic
1028156689 7:87437713-87437735 GAGGTTAGTTAACGTGCCCAAGG + Intronic
1028487470 7:91375646-91375668 GAGGTTAAAAGACTTGACCAAGG - Intergenic
1028686388 7:93593249-93593271 AAGGTTTGTAAACCTGTCCTAGG + Intronic
1028845143 7:95471907-95471929 GAGGTTAAATAACTTGCCCAAGG + Intergenic
1029063118 7:97819280-97819302 GAGGTTAAATAACTTGTTCAAGG - Intergenic
1029896848 7:103991593-103991615 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1030106918 7:105995390-105995412 GAGGTTAATAAACCAGACCAAGG + Intronic
1030130638 7:106196595-106196617 GAGGTTAAGGAACTTGTCCAGGG + Intergenic
1030268333 7:107643798-107643820 AAGGTTAGAAAACTTGCCCAAGG + Intergenic
1030291568 7:107878180-107878202 GAGGTCAGCAAATTTGTCCAAGG + Intergenic
1030782547 7:113619093-113619115 CAGGTCAGAAACCCTGTACAGGG + Intergenic
1030916418 7:115319766-115319788 GAGGTTAAATAACTTGCCCAAGG - Intergenic
1031149789 7:118040270-118040292 GGGGTCAGTATACCTGTCCATGG - Intergenic
1031393722 7:121247535-121247557 GAGGCTGGTAACCCTGTCCAGGG + Intronic
1031944448 7:127824815-127824837 GAGGTTTGTAAAGCTTTCCAAGG - Intronic
1032070361 7:128801827-128801849 GATGTTACATAACCAGTCCATGG + Intronic
1032251277 7:130259996-130260018 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1032700733 7:134376758-134376780 GAGGTTAGAAAACTTGCCTGAGG + Intergenic
1032933660 7:136703667-136703689 GAGCTTAAAAAACTTCTCCATGG + Intergenic
1032989515 7:137376862-137376884 GAGGGTTGAAAACCTGTTCTAGG + Intergenic
1033161865 7:139004807-139004829 CAGGTCAGAAACCCTGTACAGGG - Intergenic
1033356000 7:140600966-140600988 GAGGTTAGATAACTTGTTTAAGG + Intronic
1033778285 7:144638677-144638699 GAGATTAAATAACTTGTCCAAGG + Intronic
1034213234 7:149383199-149383221 GAGGTTAGATAACTTGTTTAAGG + Intergenic
1034231650 7:149534161-149534183 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1034522344 7:151630550-151630572 GAGGTTAAGTAACTTGTCCAAGG + Intronic
1035119672 7:156555892-156555914 GAGGCTAAATAACCTTTCCAAGG - Intergenic
1035504533 8:116697-116719 GAGGTTAGGTAACTTGTTCAAGG - Intergenic
1037105665 8:15104213-15104235 GAGGGTAGGAATCCTGTGCAAGG - Intronic
1037511176 8:19585005-19585027 GAGATAAGATAACTTGTCCAGGG - Intronic
1037955502 8:23054656-23054678 CAGGTCAGAAACCCTGTACAGGG - Intronic
1038219158 8:25591407-25591429 GAGGTTAAGTAACTTGTCCAGGG + Intergenic
1038237222 8:25770594-25770616 AAGCTTAGAAAACATGTTCAGGG + Intergenic
1039267266 8:35839461-35839483 GAGGTTAAGAAACTAGTCCAAGG - Intergenic
1039304387 8:36245846-36245868 GAGGTTAAGAAAACTTTCCATGG - Intergenic
1039340672 8:36646321-36646343 GAGGTTAGAAAACTCGTCCAGGG - Intergenic
1039438012 8:37574040-37574062 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1039618458 8:38975253-38975275 GAGGTTGAATAACCTGTTCAAGG + Intronic
1039904949 8:41779763-41779785 GAGGTTAAAAAACTTGCCCAAGG + Intronic
1040526663 8:48231710-48231732 CAGGTTAGAAACCCTGTGCAGGG - Intergenic
1040919802 8:52603836-52603858 CAGGTTACAAACCCTGTACAGGG - Intergenic
1040991003 8:53349272-53349294 CAGATTAGAAACCCTGTACAGGG + Intergenic
1041010323 8:53535922-53535944 GATGTTAGGAAACTTGTTCAAGG - Intergenic
1041650906 8:60301452-60301474 CAGGTCAGAAACCCTGTACAGGG + Intergenic
1041755645 8:61310355-61310377 GAGGTTAGGTGATCTGTCCAAGG + Intronic
1041911999 8:63098878-63098900 CAGGTTAGGAACCCTGTACAGGG - Intergenic
1041992951 8:64016552-64016574 GAGGTTAAATAATCTGTCCAAGG + Intergenic
1042038666 8:64566880-64566902 GAGGTTAAAAGACTTGTCTAAGG + Intergenic
1042075636 8:64991677-64991699 GAGGTTAAATAACATGTCCAGGG - Intergenic
1042122916 8:65507625-65507647 GAGGCTTGAAAACCTGCCCCAGG + Intergenic
1042404219 8:68385250-68385272 GAGGTTAAGAAACTTGTCCAAGG + Intronic
1042795925 8:72663179-72663201 GAGGTTCTATAACCTGTCTACGG + Intronic
1043069171 8:75617243-75617265 TAGATGAGGAAACCTGTCCAGGG - Intergenic
1043089431 8:75878771-75878793 GATGTTAGAAAACCGCTTCAGGG + Intergenic
1043129580 8:76444304-76444326 GAGTTTATATAACCTGTTCAGGG - Intergenic
1043800223 8:84600285-84600307 GAAATTAGAACACCTCTCCAAGG + Intronic
1044193467 8:89346826-89346848 GAGGTTAAACAACTTGTCCAAGG + Intergenic
1044202876 8:89457230-89457252 GAGGTTAGGAAATTTATCCATGG + Intergenic
1044215753 8:89608533-89608555 GAAGCTAGAAAACTTGTCTAGGG - Intergenic
1044288748 8:90442315-90442337 GAAGTTATATAACCTGTCCAGGG - Intergenic
1044858932 8:96502721-96502743 AAGGTTAAAAAACTTGCCCAAGG - Intronic
1045008302 8:97935448-97935470 GAGGTTAAATAACTTGTCCAAGG + Intronic
1045774517 8:105786252-105786274 GAAGTTAGACAAGCTATCCAAGG - Intronic
1046222492 8:111234354-111234376 CAGGTCAGAAACCCTGTACAGGG - Intergenic
1046385443 8:113502767-113502789 CAGATTAGAAACCCTGTACAGGG + Intergenic
1046477003 8:114758587-114758609 GAGGTTATACAATGTGTCCAAGG + Intergenic
1046627527 8:116590893-116590915 GGGGTTAACAAACCAGTCCAAGG + Intergenic
1046969528 8:120206192-120206214 GAAGTTAGCTAACCTGACCAAGG - Intronic
1047437731 8:124848718-124848740 GAGGTTAGGTAAGGTGTCCAAGG - Intergenic
1047468118 8:125139564-125139586 CAGGTAAGAGAACCTGTGCAGGG + Intronic
1047502624 8:125453996-125454018 GAGGTTAAATAACTTGCCCACGG + Intergenic
1047521677 8:125599823-125599845 GAGGTTAAGTAACTTGTCCAAGG + Intergenic
1047526030 8:125634844-125634866 GAGGTTAAGAAACTTATCCAAGG - Intergenic
1047526267 8:125637006-125637028 GAGGTTAAGAAACTTGTTCAAGG - Intergenic
1047581406 8:126219766-126219788 CAGGTTAGAAACCCTGTACAGGG + Intergenic
1048344351 8:133565789-133565811 GAGGTTAAACAACGTGCCCAAGG + Intronic
1048432581 8:134384001-134384023 GAGGTTAAATGACTTGTCCAAGG - Intergenic
1048556849 8:135486536-135486558 GAGGTTAAATAACTTGCCCAGGG + Intronic
1048680167 8:136832313-136832335 GAGGTTATAATAGCTGTACAAGG - Intergenic
1048686822 8:136913261-136913283 CAGGTTAGGAACCCTGTACAAGG + Intergenic
1048826319 8:138430867-138430889 GAGGTGAAATAACCTATCCATGG - Intronic
1049500745 8:142963601-142963623 CAGGTTAGAAACCCTGCACAGGG - Intergenic
1049855110 8:144856857-144856879 GAGAATAGAACACTTGTCCATGG + Intergenic
1049987025 9:961085-961107 GAGGTTAAGGGACCTGTCCAAGG + Intronic
1050336761 9:4597102-4597124 GAGGTTAAATTATCTGTCCAAGG + Intronic
1050741454 9:8825195-8825217 CAGGTTAGAAACCCTGTATAGGG + Intronic
1051196019 9:14563707-14563729 GAGGTTAAAAGAACTGTCCTGGG + Intergenic
1051698866 9:19797608-19797630 GAGCTTAGAGAACCTGCCCTGGG - Intergenic
1051869459 9:21720109-21720131 CAGGTTACAAAATCTGCCCAAGG - Intergenic
1052020880 9:23524028-23524050 GAGGTTAACTAACATGTCCAAGG - Intergenic
1052035857 9:23680052-23680074 GAGGTTTAAAAACTCGTCCAAGG - Intergenic
1052521447 9:29553103-29553125 TAGGTCAGAAACCCTGTACAGGG - Intergenic
1052625497 9:30971492-30971514 GAGGCTAAATAACTTGTCCATGG - Intergenic
1052897678 9:33763013-33763035 GACATTAGAGAACTTGTCCAAGG + Intronic
1053192975 9:36089457-36089479 GATGTTAAATAACCTGTCCAAGG + Intronic
1053209128 9:36212711-36212733 CAGGTTATAGAACATGTCCATGG + Intronic
1053668424 9:40335098-40335120 GAGGTCAGAAAAGTTGCCCAGGG + Intergenic
1053918226 9:42961395-42961417 GAGGTCAGAAAAGTTGCCCAGGG + Intergenic
1054516188 9:66041195-66041217 GAGGTCAGAAAAGTTGCCCAGGG - Intergenic
1054704332 9:68447480-68447502 GAGGTTATATGACTTGTCCAAGG - Intronic
1054898413 9:70339967-70339989 GTGGTTAGGAAACCTGCCCATGG - Intronic
1055404102 9:75956361-75956383 GTGGTTAGGAAATCTGCCCAAGG + Intronic
1055443576 9:76360351-76360373 GAGGTTAGGTAACTAGTCCAAGG + Exonic
1055865645 9:80809835-80809857 GAGGTTGGATAACATTTCCAAGG + Intergenic
1056104638 9:83334843-83334865 GAGGTTAAACAACCTACCCAAGG - Intronic
1056194586 9:84217234-84217256 AAGGTTAAGTAACCTGTCCAGGG + Intergenic
1056281398 9:85044529-85044551 GAGGTTAATTAACTTGTCCAGGG - Intergenic
1056627361 9:88264743-88264765 GAGGTTTAGAAACCTGCCCATGG - Intergenic
1057334721 9:94146882-94146904 GAGGTAGGATAACCTTTCCAAGG - Intergenic
1057391483 9:94644559-94644581 AAGGTCAAATAACCTGTCCAAGG + Intergenic
1057805371 9:98216103-98216125 GAGGTTAAGTAACTTGTCCAGGG - Intronic
1057810649 9:98254459-98254481 GAGGTTAAGTAACTTGTCCAGGG + Intronic
1057944917 9:99317681-99317703 GAGGATAGAAAACTTGCCCAAGG + Intergenic
1058120276 9:101130930-101130952 GATGTTTAATAACCTGTCCAGGG - Intronic
1058264681 9:102883650-102883672 AAGGTGAGAAAACATGTCCCAGG - Intergenic
1058372328 9:104284307-104284329 GAGGTTCTAAAACTTGACCAAGG - Intergenic
1058434272 9:104947909-104947931 AAGGTTAGAAGAGCTTTCCAGGG + Intergenic
1058884403 9:109312593-109312615 CAGGTTAAGAAACTTGTCCAAGG - Intronic
1059306144 9:113354746-113354768 GAGGTTAACTGACCTGTCCAAGG + Intronic
1059486440 9:114630779-114630801 GAGGTTAAGTAACCAGTCCATGG + Intronic
1059695640 9:116727768-116727790 GAGGTTAAATAACTTGCCCAAGG - Intronic
1060233512 9:121842895-121842917 GAGGTTAAATAATGTGTCCAAGG - Intronic
1060264784 9:122105148-122105170 GAAGTTATAAAACTTGCCCAGGG - Intergenic
1060416990 9:123437719-123437741 GACGTGAGAGAACCTGCCCAGGG - Intronic
1060844162 9:126821781-126821803 CAGGTTAGAAAAGCCGTCCTGGG - Intronic
1060866783 9:127006701-127006723 GAGGTTAATAAAACTGCCCAAGG + Intronic
1060887222 9:127162936-127162958 GAGATTAAGAAACCTGCCCAAGG - Intronic
1061674104 9:132206009-132206031 CAGGTTAGACAACTTGCCCAGGG - Intronic
1062064041 9:134516663-134516685 GGGGTTAGGCAACCTGTCCAAGG - Intergenic
1203603778 Un_KI270748v1:40686-40708 GAGGTTAGGTAACTTGTTCAAGG + Intergenic
1186263268 X:7804180-7804202 GAGGTTTTAAAACCTGGCCATGG - Intergenic
1187134169 X:16530485-16530507 GGTGTTAGAGAACCTGTCCAAGG - Intergenic
1187150389 X:16676291-16676313 CAGGTCAGAAACCCTGTACAGGG - Intronic
1187254372 X:17628755-17628777 GAGGTTAAACAACTTGCCCAAGG - Intronic
1187310109 X:18133674-18133696 GAGGTTAGCAAACTTGTCCGTGG + Intergenic
1187469614 X:19557122-19557144 GAGGTTAGAAAACATGCCCAAGG + Intronic
1187488435 X:19726315-19726337 GAGGTTATAAGACCTATCCAAGG - Intronic
1187524808 X:20044784-20044806 GAGGTTAAGTAACCTGCCCAAGG - Intronic
1187616441 X:20999686-20999708 CAGGTCAGAAACCCTGTACAGGG - Intergenic
1187829803 X:23369515-23369537 GAGCTTAAATAACTTGTCCATGG - Intronic
1187867713 X:23739283-23739305 GAGGTTAGGTAACTTGTCTAAGG - Intronic
1187945838 X:24425744-24425766 GAGGTTCCATAACCTGCCCAAGG - Intergenic
1188079247 X:25815600-25815622 GAGCCTAGAGATCCTGTCCAAGG - Intergenic
1188862585 X:35274214-35274236 CAGGTCAGGAACCCTGTCCAGGG + Intergenic
1188870710 X:35367556-35367578 CAGGTTAGAAAAGTTGTCTAAGG - Intergenic
1188960994 X:36491197-36491219 GAGGTCAGATAACTTGCCCAAGG + Intergenic
1189538192 X:41958270-41958292 GAAGTTAAATAACATGTCCAAGG - Intergenic
1190169492 X:48100668-48100690 GAGGTCAGGTGACCTGTCCAAGG + Intergenic
1190289388 X:48982231-48982253 GAGGTCAGATAACTTGCCCAAGG + Intronic
1190305583 X:49079836-49079858 GAGGTCAGAAAACCGGGCCGCGG - Exonic
1190433174 X:50397455-50397477 GAGGTTAAGTAACTTGTCCAGGG + Intronic
1190723036 X:53166868-53166890 CAGGTTAGGAACCCTGTGCAGGG - Intergenic
1190928375 X:54928406-54928428 GAGGTTAAGTAACTTGTCCAAGG + Intronic
1191004935 X:55701461-55701483 TAGGTCAGAAACCCTGTACAGGG + Intergenic
1191069670 X:56386597-56386619 CAGGTTAGGAACCCTGTACAGGG + Intergenic
1191740415 X:64432014-64432036 CAGGTCAGAAACCCTGTACAAGG - Intergenic
1191862188 X:65674903-65674925 GAAGTTAAATAACTTGTCCAAGG - Intronic
1192035474 X:67558360-67558382 GAGGTTAAGGAACATGTCCAAGG + Intronic
1192185387 X:68943479-68943501 GAGGTTAAATGACTTGTCCAAGG + Intergenic
1192190148 X:68986055-68986077 GAGGTTAAATAACTTGCCCACGG - Intergenic
1192262783 X:69517365-69517387 GAGTTTAAATAACTTGTCCAAGG - Intronic
1192497742 X:71627317-71627339 GAGGTTAAATAACCTGTCCGTGG - Intergenic
1192537382 X:71939665-71939687 GAGGTTAAGGAACTTGTCCAAGG - Intergenic
1192681284 X:73256182-73256204 CAGGTTAGAAACCCTGTACAGGG + Intergenic
1192814003 X:74572537-74572559 GAGGTTAGAAAATCTACCCTAGG - Intergenic
1192827048 X:74708324-74708346 GAGGTTAAGTAACCTGTCTAGGG - Intergenic
1192982869 X:76365829-76365851 GAGGTTGGAAAATTTTTCCATGG + Intergenic
1193228921 X:79019955-79019977 CAGGTCAGAAACCCTGTGCAAGG - Intergenic
1193531885 X:82664491-82664513 CAGGTCAGAAACCCTGTACATGG + Intergenic
1193994118 X:88344103-88344125 CAGGTCAGAAACCCTGTACAGGG + Intergenic
1194027333 X:88769501-88769523 CAGGTCAGAAACCCTGTACAGGG - Intergenic
1194147991 X:90287147-90287169 CAGGTCAGAAACCCTGTACAGGG - Intergenic
1194152608 X:90344387-90344409 TAGGGTAGAAAACCAGTCTAGGG - Intergenic
1194489139 X:94525412-94525434 GAAGGTAGAAAACCTCTCTAAGG + Intergenic
1194949058 X:100103288-100103310 GAGGTTAAAAAATTTGTTCAAGG - Intergenic
1195150611 X:102065799-102065821 CAGGTCAGAAATCCTGTACAGGG - Intergenic
1195471076 X:105230803-105230825 GAGGTTAAACAATTTGTCCAAGG + Intronic
1195963126 X:110405755-110405777 GAAGTTAGACAACCTGGGCAAGG + Intronic
1196209046 X:112973975-112973997 GAGGTTAATTAACGTGTCCAAGG - Intergenic
1196462503 X:115944956-115944978 TAGGGTTGGAAACCTGTCCATGG - Intergenic
1196488411 X:116241245-116241267 GAGGTTAGGTAACTTGGCCAAGG - Intergenic
1196677330 X:118433564-118433586 GAGGTTAAATAACTTGCCCAAGG - Intronic
1196813954 X:119650379-119650401 GAGGTTAAGTAACTTGTCCAAGG + Intronic
1197018984 X:121663394-121663416 GAGGTTAAATAACTTGTCCATGG + Intergenic
1197328121 X:125119535-125119557 TAGGCTAGAAAACCTGTCTTGGG - Intergenic
1197635750 X:128913106-128913128 GGGCTAAGAAAACCAGTCCATGG + Intergenic
1198241665 X:134793868-134793890 AAGGTTGGAAAACCTGTGAAAGG + Exonic
1198522178 X:137464232-137464254 GAAGTTAAGAAACTTGTCCAAGG + Intergenic
1198950495 X:142065853-142065875 GAAGTTAAATAACTTGTCCAAGG - Intergenic
1199043580 X:143142114-143142136 CAGGTCAGAAACCCTGTACAGGG + Intergenic
1199505591 X:148557921-148557943 GAGGTTAAATAACTTGTCCAAGG + Intronic
1199793102 X:151173338-151173360 GAGGTGAAAGAACTTGTCCAAGG - Intergenic
1199864166 X:151828033-151828055 GAGGTTAAATAACTTGTCCAAGG - Intergenic
1199869550 X:151885877-151885899 TACGTCAGAAAACCTGTACAAGG - Intergenic
1199979640 X:152913918-152913940 GAGGTTAGCTGACCTGCCCAAGG + Intergenic
1200305690 X:155024070-155024092 GAGGTTAGGCAACTTCTCCATGG + Intronic
1200494369 Y:3863906-3863928 CAGGTCAGAAACCCTGTACAGGG - Intergenic
1200498956 Y:3921132-3921154 TAGGGTAGAAAACCAGTCTAGGG - Intergenic
1201319851 Y:12686582-12686604 CAGGTCAGAAACCCTGTACAGGG - Intergenic
1201454245 Y:14150961-14150983 GAGGTTTTCAAACCTGGCCATGG + Intergenic
1201954181 Y:19603844-19603866 GCGGTTAGAGAAGCTGTACAAGG + Intergenic
1202339456 Y:23846777-23846799 GTGGTTAGAAAACCTGTATTGGG - Intergenic
1202531310 Y:25823291-25823313 GTGGTTAGAAAACCTGTATTGGG + Intergenic