ID: 913253783

View in Genome Browser
Species Human (GRCh38)
Location 1:116935878-116935900
Sequence CAGCCTTAAAAGTCCTATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913253783_913253784 -1 Left 913253783 1:116935878-116935900 CCTCAATAGGACTTTTAAGGCTG No data
Right 913253784 1:116935900-116935922 GATAAATGTTTTTCGTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913253783 Original CRISPR CAGCCTTAAAAGTCCTATTG AGG (reversed) Intronic
No off target data available for this crispr