ID: 913254431

View in Genome Browser
Species Human (GRCh38)
Location 1:116941057-116941079
Sequence AAGCACAAAGGGAGAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913254431_913254437 23 Left 913254431 1:116941057-116941079 CCTGCCTCTCTCCCTTTGTGCTT No data
Right 913254437 1:116941103-116941125 ATCAGAACAAAGAGTAGAGAAGG 0: 1
1: 0
2: 1
3: 31
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913254431 Original CRISPR AAGCACAAAGGGAGAGAGGC AGG (reversed) Intronic
No off target data available for this crispr