ID: 913254431 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:116941057-116941079 |
| Sequence | AAGCACAAAGGGAGAGAGGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 913254431_913254437 | 23 | Left | 913254431 | 1:116941057-116941079 | CCTGCCTCTCTCCCTTTGTGCTT | No data | ||
| Right | 913254437 | 1:116941103-116941125 | ATCAGAACAAAGAGTAGAGAAGG | 0: 1 1: 0 2: 1 3: 31 4: 427 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 913254431 | Original CRISPR | AAGCACAAAGGGAGAGAGGC AGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||