ID: 913256688

View in Genome Browser
Species Human (GRCh38)
Location 1:116960517-116960539
Sequence CACCCTTCTCTGCAGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913256679_913256688 23 Left 913256679 1:116960471-116960493 CCGTGGCAGAGGCAAGGGGATGC 0: 1
1: 1
2: 3
3: 33
4: 261
Right 913256688 1:116960517-116960539 CACCCTTCTCTGCAGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913256688 Original CRISPR CACCCTTCTCTGCAGGGACA TGG Intronic
No off target data available for this crispr