ID: 913257531

View in Genome Browser
Species Human (GRCh38)
Location 1:116967255-116967277
Sequence CGCCAAAGGCTGCCCCTGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913257531 Original CRISPR CGCCAAAGGCTGCCCCTGAC AGG (reversed) Exonic
900462208 1:2807114-2807136 GGCCTCAGGCTGCCCCTGAATGG + Intergenic
902939059 1:19786589-19786611 TGCCAAGGGCTGCCCCAGGCAGG + Intronic
907727838 1:57036423-57036445 CTCCAAAGGTTGCCCCAAACAGG - Intronic
908261530 1:62343006-62343028 AGCCACAGGCTTCCCCTCACTGG + Intergenic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
919455376 1:197814757-197814779 GGCCAAAGCCTGTCCCGGACTGG + Intergenic
920851489 1:209631026-209631048 TGCCAAGCGCTGCCTCTGACTGG - Intronic
922782441 1:228263896-228263918 CACCAAGGGCTGCCCCAGGCAGG - Intronic
1073250431 10:102117713-102117735 AGCCACATGCTGCCCCAGACAGG + Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083800533 11:65044070-65044092 AGCCAAAGGCTGGCCCTTAGAGG + Intronic
1091151672 11:133334848-133334870 ACCCAAAGGCCGCCCCAGACTGG - Intronic
1091403488 12:195150-195172 AGGCAAAGCCTGCCCCTGGCTGG + Intronic
1097984858 12:65772250-65772272 TGCCAAATGCAGCCTCTGACTGG - Intergenic
1103870902 12:124090904-124090926 CACCTAAGGCTGCCCTTGTCAGG + Intronic
1103962315 12:124616895-124616917 CGACAAGGGCTGCCCTTGCCCGG - Intergenic
1115899147 14:38125696-38125718 AGCAACAGGCTGCCTCTGACAGG + Intergenic
1118721397 14:68596835-68596857 TGCCAATGTCTGCCCCTGACGGG - Intronic
1122218710 14:100221656-100221678 CCCCAAAGGCTGCTCTTAACTGG + Intergenic
1123113396 14:105883192-105883214 GGCCAAAGGCTGGGCCTGCCAGG - Intergenic
1125324345 15:38521530-38521552 TGGCAAAGGCTGCCCCCCACAGG + Intronic
1126688343 15:51267460-51267482 GGCCAAAGGCCGACCCTCACAGG + Intronic
1128643548 15:69358478-69358500 CACCAGAGGCTGCCCCTGGACGG - Intronic
1129198480 15:73984789-73984811 CGCCAGAGGCTGCTTCGGACTGG + Exonic
1134207921 16:12252782-12252804 CACCAAAGGCTCCCCATGGCTGG - Intronic
1137701989 16:50503907-50503929 AGGGAAAGGCTGCCCCTGATGGG - Intergenic
1141983706 16:87565920-87565942 CACCAAAGCCTTCCCCTGAGGGG - Intergenic
1142266360 16:89065655-89065677 CGCCAAACGCTCCCTCTGATTGG - Intergenic
1143097867 17:4488108-4488130 CGCTCAAGGCTGCCCCAGCCTGG + Exonic
1144625977 17:16844696-16844718 AGCTAGAGGGTGCCCCTGACAGG + Intergenic
1144880457 17:18428024-18428046 AGCTAGAGGGTGCCCCTGACAGG - Intergenic
1145151778 17:20516363-20516385 AGCTAGAGGGTGCCCCTGACAGG + Intergenic
1147580127 17:41623394-41623416 AGCTAGAGGGTGCCCCTGACAGG + Intronic
1148779371 17:50112847-50112869 AGCCAGTGGCTGCCCCTGCCGGG + Exonic
1150493150 17:65588083-65588105 ATCCAAGGGCTGCCACTGACTGG + Intronic
1151251208 17:72836757-72836779 TGCTAAAGGCTGCCACTTACGGG - Intronic
1152129527 17:78467491-78467513 AGCCAAAGGCATCCCCTGATAGG - Intronic
1152238615 17:79150794-79150816 GGCCACAGGGTGCCTCTGACTGG + Intronic
1157559589 18:48637135-48637157 CCCCACAGGCTGCCCCTCCCAGG - Intronic
1162248448 19:9422727-9422749 CGCTAAAGGCTGACCCTGAAGGG + Intronic
1162426923 19:10602575-10602597 CAGCAGAGGCGGCCCCTGACCGG - Intronic
1163149375 19:15401942-15401964 CGCCCAAGGCTGCTCCTCACAGG + Intronic
1163359346 19:16836080-16836102 CGCCAAAGGCTGCCCGAGGCTGG - Intronic
925318107 2:2940446-2940468 CCCCAGAGCCTGCCCCTGCCAGG + Intergenic
927636008 2:24817439-24817461 GGACTAAGGCTGCCCCTTACTGG - Intronic
932302449 2:70676770-70676792 GAGCAGAGGCTGCCCCTGACTGG - Intronic
932607125 2:73172778-73172800 GGCCAGAGGCTGCCCCTTAGAGG - Intergenic
933110435 2:78393469-78393491 CCCCAAATGCAACCCCTGACAGG + Intergenic
934759019 2:96843279-96843301 CGCCAGAGGCTGCACCAGGCTGG + Intronic
936856475 2:116964347-116964369 GGCCAAAGGCTGCCATTGATGGG - Intergenic
937735698 2:125285711-125285733 GGTCGAAGGCTTCCCCTGACTGG + Intergenic
939134070 2:138273423-138273445 CGCCCATTGCTGCTCCTGACTGG - Intergenic
939669343 2:144990793-144990815 CTCCACAGGCAGCACCTGACTGG - Intergenic
939884295 2:147664458-147664480 CCCCAGAGGCAGCCCCTGAAAGG - Intergenic
940762097 2:157749909-157749931 CGCCCAGTGCTGCCCCTGTCAGG + Intronic
946416914 2:219544283-219544305 CGCCAGAGGCTCCAACTGACTGG - Exonic
948811026 2:240478516-240478538 AGCCACAGGCTGCCCCTGGGAGG - Intergenic
1171390558 20:24799078-24799100 CGCAAAAGGCAGGCCCTGGCTGG + Intergenic
1171442464 20:25176408-25176430 AGCCAAGGGCAGCCCCTGTCTGG + Intergenic
1172095417 20:32457793-32457815 CGCCCATAGCTGCCCCTCACTGG + Intronic
1175929179 20:62485566-62485588 CGCCAGAGGCAGCCGCAGACCGG + Intergenic
1176215977 20:63947942-63947964 CCCCAGAGGCTGCCCCTCCCAGG - Intronic
1179510713 21:41871435-41871457 AGCCACAGGCTGTCCCTGTCTGG + Intronic
1179912783 21:44459245-44459267 CGCCACATGCTGGCCCTGCCTGG - Exonic
1180068536 21:45424723-45424745 GGCCAAGGGCTGCCCCGGAAGGG - Intronic
1181102537 22:20551050-20551072 CACCCACGGCTGCCTCTGACAGG + Intronic
1181138548 22:20786695-20786717 GTGCAACGGCTGCCCCTGACAGG + Intronic
1181235191 22:21444297-21444319 CGCCAAGTGCTGCCCCAGCCTGG - Intronic
1181595015 22:23908464-23908486 TGCCAGAGGCTGGCCCTGCCAGG - Intergenic
1183688418 22:39375039-39375061 TGCCAAAGGCTGCTTCTGAAGGG - Intronic
1183831621 22:40421124-40421146 AGCCTGAGGCTGCCCCTGAATGG - Intronic
1184477648 22:44730092-44730114 CCCCCAGGGCTGCCCCTGGCGGG + Intronic
1185081037 22:48709487-48709509 AACGAAAGGCTGCGCCTGACTGG - Intronic
958579513 3:96000021-96000043 CGAGAAAGGCTGCTCCTGCCGGG + Intergenic
961324775 3:126103617-126103639 AGCCAAGGGCTGCTTCTGACTGG + Exonic
961449887 3:126997928-126997950 CTCACAAGGCTGCCCCTGCCAGG - Intronic
962828934 3:139122876-139122898 AGCCAAAGGCAGCCCCTCAAAGG + Intronic
964223033 3:154368157-154368179 CGCCAGAGGCTCCCCCTGCAAGG + Intronic
964891393 3:161540325-161540347 AGCCCAGGGCTGCCCCTGCCTGG - Intergenic
964917246 3:161852949-161852971 CGCCAGAGGCTCCCCCTGCATGG - Intergenic
965913318 3:173810006-173810028 AGCCAAAGGCTGTCCTTGATAGG + Intronic
975012713 4:69376955-69376977 CGCCAAAGGCCTCCCCTGCAAGG + Intronic
993626091 5:90226601-90226623 GGCCAAAGGCTGCAACTAACAGG - Intergenic
1003364360 6:5458220-5458242 CAGCAAAGCCTGCCCATGACTGG + Intronic
1004459453 6:15822027-15822049 AGGCAAAGGCTACCCATGACTGG + Intergenic
1006251951 6:32795065-32795087 CCCCAAGGGCTGCTCCTCACCGG + Intergenic
1017603129 6:156105033-156105055 CACCCAATGCTGCCCTTGACAGG + Intergenic
1019475534 7:1242403-1242425 CCCCACAGGCTGCGCCTGACGGG + Intergenic
1019788705 7:2996463-2996485 CACCAAAAGCTGCCACTGCCTGG + Intronic
1026541838 7:71286562-71286584 CGGCAAAGGCTCCTCCTGAGAGG - Intronic
1034907350 7:154962026-154962048 CACCAAAGGCGGCCCCTGTTGGG - Intronic
1037803031 8:22045295-22045317 GCCCAATGGCTGCCCCTGGCAGG - Intronic
1039079648 8:33722406-33722428 CGCCAGAGGCTGCCCATAGCAGG + Intergenic
1040314386 8:46253300-46253322 CCCCTAAGGGTGCCCCTGGCAGG + Intergenic
1040330906 8:46385322-46385344 CCCCCAAGGCTGCCCCGGGCTGG + Intergenic
1045331094 8:101156282-101156304 CTACAAAGGCAGCACCTGACTGG - Intergenic
1045929586 8:107606040-107606062 CGCCAGAGGCTCCCCCTGCACGG - Intergenic
1056803168 9:89708239-89708261 CGCCATAGGCTGGCACAGACTGG + Intergenic
1057291504 9:93810141-93810163 CGCCTCAGGCTGCCCCTAGCAGG - Intergenic
1061883520 9:133579488-133579510 TGGGAAAGGCTACCCCTGACTGG + Intronic
1062424538 9:136500024-136500046 CTGCAAAGGCAGCCCCTGCCAGG + Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1189839848 X:45063576-45063598 GGCCAAAGGCTGCCCAGGGCAGG - Exonic
1198296850 X:135295680-135295702 CCCCAAAGGCTGCAACTGGCAGG + Intronic
1201190348 Y:11438653-11438675 AGCCAAAGGCTGGCCCTGGTTGG + Intergenic