ID: 913260140

View in Genome Browser
Species Human (GRCh38)
Location 1:116990428-116990450
Sequence GAAGGTGCTAAAGTTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913260140 Original CRISPR GAAGGTGCTAAAGTTGCTGC TGG (reversed) Intergenic
900364784 1:2306675-2306697 GAAGGTGGTGAAGGAGCTGCAGG + Exonic
901361390 1:8703533-8703555 GAAGGAGATAAAATTGCAGCTGG - Intronic
902086831 1:13869087-13869109 ATTGGTGCTAAAGTTCCTGCAGG - Intergenic
902796264 1:18802518-18802540 GTTGGTGTTAATGTTGCTGCTGG - Intergenic
902823872 1:18959381-18959403 GAAGGAGCTAAAGGGGCTCCAGG + Intergenic
903424654 1:23244916-23244938 GAAGGTCCTAAAGAAGATGCAGG + Intergenic
903495430 1:23763291-23763313 GCAAGTGCTAAAGCTCCTGCAGG - Intergenic
903704972 1:25279003-25279025 GTTGGTGCTGAAGTTTCTGCAGG + Intronic
904887003 1:33746361-33746383 AAAGGTGCTAAAGTTTCAGAGGG + Intronic
911965661 1:104366687-104366709 GAAGGTTGTAAAGTTTCTACAGG - Intergenic
913260140 1:116990428-116990450 GAAGGTGCTAAAGTTGCTGCTGG - Intergenic
915122229 1:153636663-153636685 GAAGGAGTTGAAGTTGCTGTTGG - Intronic
916120709 1:161525696-161525718 CAAGGTGCAGAAGTTGCTGCAGG + Exonic
916130476 1:161607329-161607351 CAAGGTGCAGAAGTTGCTGCAGG + Intronic
916582899 1:166124188-166124210 GAAGGTGCAAAAGATGTTCCAGG - Intronic
918929213 1:190832667-190832689 GAAGCTGCCAAAGTTTCTTCTGG + Intergenic
919765886 1:201127178-201127200 GAGGCTGCTGAAGGTGCTGCTGG - Exonic
923945986 1:238888188-238888210 GGAGTTGCAAAAGTTGCAGCCGG + Intergenic
924412349 1:243819440-243819462 GGAGTTGCTAAAATTCCTGCAGG - Intronic
924740772 1:246793308-246793330 GAAGGTGGGACAGTGGCTGCTGG + Intergenic
924740835 1:246793540-246793562 GAAGGTGGGACAGTGGCTGCTGG + Intergenic
1065812603 10:29456055-29456077 GAAGGAGCTTGAGTTGCTACAGG - Intergenic
1065959080 10:30719490-30719512 GAAGGAGCTCGAGTTGCTACAGG + Intergenic
1067260174 10:44682705-44682727 GAAGGTGCTCAAGTGTCAGCTGG - Intergenic
1070328162 10:75401176-75401198 CAAGGTGCTGAAGATGCTGACGG - Exonic
1078691253 11:13582752-13582774 GGAGTTGCTGAAGTTCCTGCAGG - Intergenic
1082660417 11:55903029-55903051 GAAGGTTCTTAAATTGATGCGGG + Intergenic
1083918377 11:65765336-65765358 TAAGGTGCAAACCTTGCTGCTGG + Intergenic
1084421048 11:69060761-69060783 GGAGGTGCTGAAGATGCTGCTGG - Intronic
1085708979 11:78812177-78812199 GCAGGTGCCATGGTTGCTGCAGG + Exonic
1088470211 11:110182071-110182093 AAAGCTGCTAAAGCAGCTGCTGG - Intronic
1090740823 11:129658483-129658505 GGAGCTGCTGAAATTGCTGCAGG - Intergenic
1096968075 12:55644422-55644444 GCAGGTGCTGAGGCTGCTGCTGG - Intergenic
1097056925 12:56255963-56255985 GAAGGTGCTGGGGCTGCTGCTGG - Exonic
1098153162 12:67569300-67569322 GAATGTGCAAAATCTGCTGCAGG + Intergenic
1100275824 12:93071025-93071047 GAAGATACTAGAGTTGCTGAAGG - Intergenic
1101581375 12:106044661-106044683 GAAGTTGCTGAGGTTGCTCCTGG + Intergenic
1102554473 12:113717879-113717901 GCAGGTGGTAAGGTTGCTGGTGG + Intergenic
1103508429 12:121456742-121456764 GAAGGTGCTTTGGTTGGTGCAGG - Intronic
1104798865 12:131539595-131539617 GATGGTGCTAATGATGATGCTGG + Intergenic
1105209168 13:18247750-18247772 GAAGGTGCTGCTGCTGCTGCAGG - Intergenic
1108556144 13:51594801-51594823 GCAGGTGCTGCAGGTGCTGCAGG - Intronic
1109911961 13:68923935-68923957 AAAGGTGCCAAAGTTGTTGTGGG - Intergenic
1110799013 13:79673231-79673253 GAAGGTGCTAAAGGGCCTGGAGG - Intergenic
1110962184 13:81640455-81640477 GTGGGAGCTAGAGTTGCTGCAGG + Intergenic
1111428046 13:88115406-88115428 GAAGGTGCTAGAAATGGTGCTGG + Intergenic
1113003383 13:105670385-105670407 GAAGGTGCTAAAACCACTGCAGG + Intergenic
1114162041 14:20179238-20179260 GAAGGTGCTGGAGTTGCTGGGGG - Intergenic
1114469249 14:22947894-22947916 GAAGGAGCAGATGTTGCTGCTGG - Exonic
1115863280 14:37713240-37713262 GAAGGTTCTAATGTTTCTGTTGG - Intronic
1117364318 14:55010315-55010337 GATGGTACTAAAATTGCTGCTGG - Exonic
1119399980 14:74356810-74356832 GAAGGTGCTGCAGGAGCTGCAGG + Exonic
1119892930 14:78196625-78196647 GAAGGTGCTGCAGTAGGTGCAGG + Intergenic
1122769563 14:104091969-104091991 GAAGGTGGCAGAGTTGCTGGGGG + Intronic
1122969877 14:105148183-105148205 GCAGGTGCCACCGTTGCTGCAGG + Exonic
1123137782 14:106045446-106045468 GAAGGTGCTCAGGATGCCGCAGG - Intergenic
1126910327 15:53410586-53410608 GACGATGCAAAAGTTGCTGCAGG + Intergenic
1130652395 15:85769504-85769526 GGAGGTGCTGGAGCTGCTGCTGG - Exonic
1131092455 15:89632933-89632955 GAAGGTGCTACAGCAGCGGCGGG - Exonic
1131620143 15:94059629-94059651 GAAGGGGATAAAGATGTTGCTGG - Intergenic
1132861115 16:2072252-2072274 GAAGGTGCTGAAGCTGGTTCTGG + Exonic
1134131683 16:11654606-11654628 GCCAGTGTTAAAGTTGCTGCGGG + Intergenic
1135742054 16:24984340-24984362 GAAGGTGCTGAGCTTGCCGCTGG - Intronic
1137377237 16:47962622-47962644 GAAGGTGACACTGTTGCTGCTGG + Intergenic
1139956322 16:70694750-70694772 GAATGTGCAAAAGTGGCAGCTGG - Intronic
1140667161 16:77238310-77238332 GTACGTGCTAAAGTAGATGCTGG + Intergenic
1140754407 16:78054741-78054763 GAAGGCACAAAAGTTGCAGCAGG + Intronic
1140897968 16:79341851-79341873 GAAAGTGATAAACTTGCTGGTGG + Intergenic
1147855452 17:43476350-43476372 GAAGGTCCTAAAGAAGATGCAGG + Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1147959021 17:44154866-44154888 GACGGTGCACAGGTTGCTGCTGG + Exonic
1148795811 17:50196162-50196184 GATGGTGCTACTGGTGCTGCCGG - Exonic
1150265470 17:63829865-63829887 GGAGGAGCTACAGCTGCTGCAGG + Exonic
1155100862 18:22608417-22608439 GCAGGTGGCAAAGTTGTTGCTGG - Intergenic
1157753192 18:50195815-50195837 AGAGGAGCTGAAGTTGCTGCAGG - Intergenic
1159050399 18:63416268-63416290 GGAGGAGCTACAGCTGCTGCAGG - Intronic
1159936313 18:74370728-74370750 GAAGCTTCTGAAGTTCCTGCGGG - Intergenic
1168443542 19:56392241-56392263 AAAGGTGTTATATTTGCTGCAGG - Intronic
924987363 2:284384-284406 GAAGGCACTAAAGTTCCTTCAGG + Intronic
926690657 2:15731087-15731109 GCAGCTCCTACAGTTGCTGCTGG - Intronic
926717866 2:15939314-15939336 GAAGGGGCCAATGCTGCTGCTGG + Intergenic
928345014 2:30484262-30484284 GAATGTGCTAAAGGTTCTGCAGG + Intronic
931252638 2:60547413-60547435 GAAGCTGGTAAAGTAGATGCTGG - Intronic
931890888 2:66670816-66670838 TAAGGTACTAAAGTTCCTGTTGG - Intergenic
933722733 2:85408789-85408811 GAAAGTGCTAAAGTTGAAGAGGG + Intronic
934909791 2:98241282-98241304 GAAGGTGATAAAGCTGGTGAAGG + Intronic
937803818 2:126114016-126114038 GAATGTGCTACACCTGCTGCAGG - Intergenic
939887340 2:147695246-147695268 GAAGTTGCTAAACTTGTTACTGG + Intergenic
940779189 2:157915159-157915181 GATGGTGCTAATGCTGCTACTGG + Intronic
941331720 2:164185776-164185798 GGAGCTGCTAGAGTTGCTGGTGG + Intergenic
941638040 2:167957080-167957102 GAAAATGCTAGAGTTGATGCTGG - Intronic
941860557 2:170274527-170274549 GTAGGCACTAAAGATGCTGCAGG + Intronic
944378926 2:199084196-199084218 AAAGGTATTAAACTTGCTGCAGG - Intergenic
1170079457 20:12455894-12455916 CATTGTGCTAAAGTTGCTGGAGG + Intergenic
1170270749 20:14524729-14524751 GAAGGTGGTAAAGTTGGGGTGGG - Intronic
1170589177 20:17758293-17758315 GAAGGTGCTAAGGACGCTGGAGG + Intergenic
1172445923 20:34993393-34993415 CAAGGTGCTGACGCTGCTGCAGG + Exonic
1173091302 20:39974823-39974845 GAAGTTGTTAAAGTTCCTGCAGG + Intergenic
1175121139 20:56717163-56717185 AAAGGTGCTAAAGAGGCTTCTGG + Intergenic
1177436429 21:21059824-21059846 GAAGCTGCTAAATATGCTACAGG + Intronic
1181873821 22:25924291-25924313 GAGGGAGCTAACTTTGCTGCTGG + Intronic
1184657862 22:45950874-45950896 GTAGGTGCTCAATTTGCTGCAGG - Intronic
1185373926 22:50473595-50473617 GAAGATGCTAAAGAGGCTTCAGG + Intronic
950202130 3:11052384-11052406 GAAGATGCTGGAGTTTCTGCTGG + Intergenic
950202911 3:11057501-11057523 GAAGGGGCTAAAGGGTCTGCTGG + Intergenic
953269246 3:41424216-41424238 GGAGTTGCTGAAATTGCTGCAGG - Intronic
953683138 3:45054823-45054845 GCAGTTGCTACAGCTGCTGCTGG - Intergenic
954082751 3:48222081-48222103 GAAGGAGCCAAAGGTGCTTCAGG + Intergenic
954392365 3:50274367-50274389 GAAGGTGCCAAAGGTCTTGCTGG - Exonic
954529237 3:51304111-51304133 GAAGTTGCTAAAATTCCTGCAGG + Intronic
954684836 3:52364865-52364887 GAACGTGCCCAAGTTCCTGCAGG + Exonic
955897863 3:63719849-63719871 CAAAGTGCTTAATTTGCTGCAGG - Intergenic
957768615 3:84658777-84658799 GAGGGTGCAAAAGCTGCTGGTGG - Intergenic
959245836 3:103866491-103866513 GGAGGTACTAAAGTTGCAGATGG - Intergenic
961714242 3:128847782-128847804 GGAGGTGTCCAAGTTGCTGCCGG - Intergenic
964783792 3:160371387-160371409 GAATGTGCTTAAGGTGCTGTTGG - Intronic
969120782 4:4909477-4909499 GAAGATGCTCAACTTCCTGCTGG + Intergenic
969350890 4:6597264-6597286 GAAGCTGCTGGAGCTGCTGCAGG - Exonic
971346746 4:25818471-25818493 AAATGTGCCAAAGTTGCTGATGG + Intronic
974521130 4:62980885-62980907 GAAGGTGTTAAAATTACTGAGGG - Intergenic
974913236 4:68148563-68148585 GGAGTTGCTGAAGTTCCTGCAGG + Intergenic
977086143 4:92601078-92601100 GAAGTTGCTGAAATTCCTGCAGG + Intronic
977272140 4:94930130-94930152 GAAGGTGCAAAACTGGCTGCAGG - Intronic
978829531 4:113067466-113067488 GTAGGTCCTAAAGTTTCTGATGG + Intronic
978940400 4:114429348-114429370 GAAGTTGCTGGAGTTCCTGCAGG + Intergenic
984764856 4:183392370-183392392 AAAGGTGCTAGAGATGGTGCTGG - Intergenic
985802293 5:2012608-2012630 GAAGGGTCTGAAGATGCTGCCGG + Intergenic
988716034 5:33829246-33829268 GAAGATGCTCAGGCTGCTGCAGG + Intronic
989135011 5:38144884-38144906 GAAGCTGCTATATATGCTGCCGG + Intergenic
989140531 5:38197124-38197146 GAAGGTGCTACAGTTGAAACAGG + Intergenic
989745657 5:44826354-44826376 GACTTTGCTAAAGTTGCTGAAGG + Intergenic
990934971 5:61138427-61138449 GAAGGTGATTTAGCTGCTGCTGG + Intronic
997120340 5:131166636-131166658 CCAGGTGATACAGTTGCTGCTGG + Intronic
998246104 5:140506831-140506853 GTAGGTGGTAGACTTGCTGCTGG + Exonic
998544990 5:143019947-143019969 GAATATGCTGAAGTTGCTGCAGG + Intronic
1001512934 5:172336464-172336486 GAAGGCACTAAAGATGCTACAGG + Exonic
1006122693 6:31816788-31816810 CAAGGTGCAGAAGCTGCTGCAGG + Exonic
1006124556 6:31828982-31829004 CAAGGTGCAGAAGCTGCTGCAGG + Exonic
1007635058 6:43294711-43294733 GATGGTGGTAATGTTGCTGGTGG - Intergenic
1009707111 6:67266258-67266280 GAAGTTGCTGAAATTCCTGCCGG + Intergenic
1012075054 6:94672690-94672712 GGAGTTGCTACAGTTCCTGCAGG - Intergenic
1016363209 6:143290086-143290108 GAAGGTGATAATGTTACTGGCGG + Intronic
1016560462 6:145390846-145390868 GAAGGTGAAAAGTTTGCTGCAGG - Intergenic
1017611191 6:156188124-156188146 GAAGGTGCTAGAGTTTCTTTAGG + Intergenic
1018049447 6:159996548-159996570 GAAGGTGCCAAGGTGTCTGCGGG + Intronic
1019390806 7:785917-785939 GATGCTGCTGAAGTGGCTGCGGG - Exonic
1019866043 7:3711560-3711582 GAAGGAGCCAGAGATGCTGCTGG + Intronic
1021121280 7:16798444-16798466 GAAGGTGCTAGAGCTGCTTCAGG + Intronic
1022434698 7:30371760-30371782 GGAGGAGCTACAGCTGCTGCAGG + Intronic
1022957132 7:35391170-35391192 GAAGGTGATATGGTTGCTGCAGG + Intergenic
1025041707 7:55651440-55651462 GGAGTTGCTAAAATTCCTGCAGG - Intergenic
1026734681 7:72942148-72942170 GGAGGTGCTGAAGATGCAGCAGG - Exonic
1026955080 7:74371994-74372016 GAAGGGGTTAAAGCAGCTGCAGG - Intronic
1028027673 7:85866875-85866897 GGAGTTGCTAAAATTCCTGCAGG - Intergenic
1029458396 7:100682403-100682425 GAAGCTGCTGAAGCTGCTGCAGG - Exonic
1030366778 7:108655737-108655759 GAAGGTGCAATACTTGCAGCTGG + Intergenic
1030521063 7:110598748-110598770 GAGGGTGGTATAGTTGCTGTAGG - Intergenic
1033868228 7:145718419-145718441 GGAGTTGCTAAAATTCCTGCAGG + Intergenic
1036054229 8:5232513-5232535 AAAGCTGGTAAAGTTTCTGCAGG - Intergenic
1037255218 8:16945124-16945146 GAAGTGCTTAAAGTTGCTGCTGG + Intergenic
1037782758 8:21881956-21881978 GAAGGAGTGAAAGTTGCTTCAGG - Intergenic
1042795678 8:72660856-72660878 AAAGGAGCTAAAGTTTCTCCTGG + Intronic
1043466242 8:80510140-80510162 GAAGGTAATAAAGTGGATGCTGG + Intronic
1043909039 8:85839222-85839244 GGAGGAGCTAGAGGTGCTGCAGG - Intergenic
1047533968 8:125702217-125702239 GAAGGTGCAAAAGTTAATACAGG + Intergenic
1049797989 8:144505245-144505267 GACGGTGCTGAAGCTGCTGGTGG + Exonic
1050614870 9:7391537-7391559 GAAGGTGCTAATGATACTGTGGG - Intergenic
1051867961 9:21703009-21703031 GAAGGAGCTAAGCTTACTGCAGG - Intergenic
1053039381 9:34856955-34856977 GGAGTTGCTAAAATTTCTGCAGG + Intergenic
1057141479 9:92729107-92729129 GAAGGTGCTAGAGCTGCAGACGG - Exonic
1058893340 9:109379880-109379902 GAAGGAGCAAAAGTCCCTGCGGG + Intronic
1059224494 9:112659414-112659436 GGAGGAGCTGAAGGTGCTGCTGG - Exonic
1060536388 9:124392383-124392405 AAAGCTGCCAAAGTTGCTCCAGG + Intronic
1186860642 X:13669244-13669266 GAAGTTGTAAAAGTAGCTGCCGG - Intronic
1187506076 X:19879586-19879608 GAAGTTGTTAAACTTGCTTCTGG - Intronic
1188243173 X:27812552-27812574 GAAGGTGCTAAATATGATGGGGG + Intronic
1191034391 X:56008886-56008908 GGAGTTGCTGAAGTTTCTGCAGG - Intergenic
1191185528 X:57607415-57607437 GGAGTTGCTAAAATTCCTGCTGG + Intergenic
1191698117 X:64010375-64010397 GAAGGACTGAAAGTTGCTGCAGG + Intergenic
1194307449 X:92265899-92265921 AAAGGTGCTAAAGATGTTTCTGG + Intronic
1196284500 X:113863772-113863794 GAAATTGCTAAAATTTCTGCAGG + Intergenic
1198313056 X:135438635-135438657 GAAGGGACCAAAGTTGCAGCAGG + Intergenic
1199186620 X:144922753-144922775 GGAAGTGCTTGAGTTGCTGCTGG + Intergenic
1199735114 X:150678833-150678855 GATGGTACTGAAGTTGCTGGTGG + Intergenic