ID: 913263185

View in Genome Browser
Species Human (GRCh38)
Location 1:117019621-117019643
Sequence GGTAGGGACGAGTCCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913263185 Original CRISPR GGTAGGGACGAGTCCACTGC AGG (reversed) Intronic
901134266 1:6982872-6982894 GGTGGGGACCAGGCCAATGCAGG + Intronic
904793114 1:33038552-33038574 GGTAAGGAAGAGACCACAGCTGG - Intronic
908079716 1:60563227-60563249 TGCAGGGACCAGTCCTCTGCAGG - Intergenic
913263185 1:117019621-117019643 GGTAGGGACGAGTCCACTGCAGG - Intronic
920253375 1:204637717-204637739 GGTAGAGAGGACTCCTCTGCGGG + Intronic
1064031795 10:11887413-11887435 TGGAGGGACCAGTCCACTGCAGG + Intergenic
1064392248 10:14952064-14952086 AGTAGGGAAGAGTCCATTTCTGG + Intronic
1065207908 10:23374591-23374613 GGTTGGGCTGAGTCCACTTCTGG + Intergenic
1067755695 10:49002587-49002609 CGCAGGGACCAGTCCACAGCCGG - Intergenic
1070809395 10:79290020-79290042 GGTGGAGACGTGTCCACAGCTGG - Intronic
1076865546 10:133164657-133164679 GGTAGGTTCAAGTCCACAGCTGG - Intronic
1078023346 11:7673073-7673095 GGTAGGGAGGGGTCAGCTGCAGG + Intronic
1083592891 11:63905572-63905594 GTTAGGGAAGAGGCCACTGTAGG - Intronic
1084604088 11:70162414-70162436 GGTAGGGAGGAGTCCACGTAGGG + Intronic
1089324772 11:117649616-117649638 GGTAGGGACGAGCCCAGAGCAGG - Intronic
1090998700 11:131890033-131890055 GTCAGGGAGGAGTGCACTGCTGG - Intronic
1093328528 12:17808639-17808661 GGTGGGGAGGAGTCCACCCCTGG - Intergenic
1095358666 12:41308291-41308313 TATAGGAAAGAGTCCACTGCTGG - Intronic
1130889062 15:88117961-88117983 AGTAGAGAGGAGTGCACTGCAGG - Intronic
1131119758 15:89814848-89814870 GGAAAGGAGGAGTCCAGTGCTGG - Exonic
1132392039 15:101446161-101446183 GGGAGGGACGCTCCCACTGCAGG + Intronic
1138195393 16:55048115-55048137 GGTAGGGAGGAGTCCCCTCGGGG + Intergenic
1138204357 16:55114054-55114076 GATAAGCACGAGTCCACTTCTGG - Intergenic
1141891655 16:86930321-86930343 GGAAGGGACGAAACCAATGCAGG - Intergenic
1147591514 17:41686912-41686934 GGTAGGAAGGAGTCCACTGTGGG - Intergenic
1151713627 17:75820379-75820401 GCTAGGCACGAGGCCAGTGCAGG + Intronic
1152026229 17:77811176-77811198 GGTAGGGACACGTGGACTGCTGG - Intergenic
1164241012 19:23389177-23389199 GGTAGGGAAGAGTACACTCCAGG + Intronic
1166355530 19:42225190-42225212 GGAGGTGACGAGTCCACAGCTGG + Exonic
1168242923 19:55096234-55096256 GGGAGGGAGGAGTCCAGGGCTGG - Intronic
936076347 2:109404136-109404158 GGTGTGGCCGAGACCACTGCAGG + Intronic
940923169 2:159332276-159332298 GCCAGGGATGAGACCACTGCAGG + Intronic
1171488193 20:25498626-25498648 GGCAGGGGCAAGTCCCCTGCAGG + Intronic
1174147024 20:48459189-48459211 GGTGGGGACGGGTCCAAGGCAGG - Intergenic
1180049612 21:45325246-45325268 GGGAGGGGCGAGTGCCCTGCGGG + Intergenic
1183369895 22:37426671-37426693 GGCAGGGCCGGGGCCACTGCCGG - Intronic
956736942 3:72245396-72245418 GGCTGGGATGAGTCTACTGCAGG - Intergenic
959872463 3:111343691-111343713 GGAAGGGACAAGTTCAGTGCAGG - Intronic
966690185 3:182733487-182733509 GGTAAGGAAGAATCGACTGCTGG - Intergenic
967929876 3:194683221-194683243 GGCAGGGAGGAGTCTACTGGTGG - Intergenic
968083069 3:195860251-195860273 GGTAGGGACGAAAGCGCTGCAGG - Intergenic
985621996 5:960686-960708 GGTGGGGAGGAGGCCTCTGCAGG - Intergenic
1014930503 6:127330298-127330320 GTTAGGGAAGATTCCACAGCTGG + Intronic
1016949720 6:149567257-149567279 GGTAGGCACGACTCTACGGCAGG - Intronic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1027248449 7:76383270-76383292 GGTAGGGCCTAGGCCACTGAGGG - Intergenic
1030058504 7:105603791-105603813 GGCAGGGACGAGGCCACAGAAGG - Intergenic
1032799649 7:135307779-135307801 GGTAGGGCTGAGCCCACAGCAGG + Intergenic
1034274743 7:149819183-149819205 GCTCTGGACGAGGCCACTGCTGG + Intergenic
1038437345 8:27545397-27545419 GGCAGGGGAGAGACCACTGCAGG - Exonic
1039741786 8:40389616-40389638 GTTAGGGACAAGCCCACTGTTGG - Intergenic
1049709197 8:144056097-144056119 GATGTGGACGGGTCCACTGCGGG - Intronic
1056976170 9:91256743-91256765 GGTAGGGAGGAGAACACTGGTGG + Intronic
1191036627 X:56031607-56031629 GGTAGGCTGGAGTCCTCTGCAGG + Intergenic