ID: 913267455

View in Genome Browser
Species Human (GRCh38)
Location 1:117059432-117059454
Sequence TTCTCTAGGCTCGCCCAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913267455_913267457 -6 Left 913267455 1:117059432-117059454 CCACGCTGGGCGAGCCTAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 913267457 1:117059449-117059471 AGAGAACATCCAGTACACACAGG 0: 1
1: 0
2: 1
3: 19
4: 193
913267455_913267459 8 Left 913267455 1:117059432-117059454 CCACGCTGGGCGAGCCTAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 913267459 1:117059463-117059485 ACACACAGGAAGCAGCAGCGCGG 0: 1
1: 0
2: 7
3: 35
4: 386
913267455_913267460 9 Left 913267455 1:117059432-117059454 CCACGCTGGGCGAGCCTAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 913267460 1:117059464-117059486 CACACAGGAAGCAGCAGCGCGGG 0: 1
1: 0
2: 3
3: 45
4: 389
913267455_913267461 17 Left 913267455 1:117059432-117059454 CCACGCTGGGCGAGCCTAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 55
Right 913267461 1:117059472-117059494 AAGCAGCAGCGCGGGCCAAATGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913267455 Original CRISPR TTCTCTAGGCTCGCCCAGCG TGG (reversed) Intergenic
913267455 1:117059432-117059454 TTCTCTAGGCTCGCCCAGCGTGG - Intergenic
913581747 1:120233472-120233494 TTCTGTAGCCTCGCCCTGCCTGG + Intergenic
913626430 1:120664916-120664938 TTCTGTAGCCTCGCCCTGCCTGG - Intergenic
914563678 1:148844919-148844941 TTCTGTAGCCTCGCCCTGCCTGG + Intronic
914609149 1:149285307-149285329 TTCTGTAGCCTCGCCCTGCCTGG - Intergenic
915107730 1:153544921-153544943 TGCTCTGGGCTCCCCCAGGGAGG - Intronic
918211962 1:182359096-182359118 TTCGCTAGGCTTGCCCAGGCTGG + Intergenic
924824443 1:247524443-247524465 TTCTCCAGGCTCACCCTGCATGG + Intronic
1075505059 10:123013919-123013941 TTCTCTAGGCTGGCCAAGGCTGG - Intronic
1090003253 11:122979779-122979801 TTCCGTAGGGTCGGCCAGCGCGG + Intronic
1090621334 11:128563631-128563653 CTCTGCAGGCTCGCCCACCGTGG - Intronic
1091383488 12:77804-77826 TTCCCCAGGCTGGCCCGGCGAGG - Intronic
1099413753 12:82361835-82361857 TTCTCTAGGCTGGCCGAGGCTGG - Intronic
1103982597 12:124746239-124746261 TTCTCTTGGGTCAGCCAGCGGGG - Intergenic
1106284464 13:28306797-28306819 TACTCTTGCCTGGCCCAGCGGGG + Intronic
1109235521 13:59813389-59813411 TTCTCTAATCTGGCCCAGAGTGG + Intronic
1117911712 14:60643158-60643180 TTCTCTGGGCTAGGACAGCGTGG - Intergenic
1120710718 14:87790244-87790266 TCCTCTAGACTCTCCCAGGGAGG + Intergenic
1202855491 14_GL000225v1_random:48564-48586 TTATCTAGGCTCTCCCTGCAGGG - Intergenic
1131979135 15:97978919-97978941 TTCTCTAGCCTTGGCCAGCCAGG + Intergenic
1133744661 16:8676914-8676936 TTCTCTAGGACCACCCAGCTGGG + Intronic
1141799692 16:86298414-86298436 TCCTCTCCCCTCGCCCAGCGTGG + Intergenic
1144867285 17:18344860-18344882 TGCTCTAGCCTGGCCCTGCGTGG + Intronic
1150492703 17:65585286-65585308 TTCTCTTGGATCGGCCAGAGGGG - Intronic
1151022881 17:70639689-70639711 TTCTTTATGCACGGCCAGCGAGG - Intergenic
1153224109 18:2884836-2884858 CTCTCCAGGCTGGCCCAGAGGGG - Intronic
1153466539 18:5394637-5394659 TTCTCTAGGCTTGCCTAGGCTGG - Intronic
1161065897 19:2237072-2237094 CCCTCCAGGCCCGCCCAGCGCGG - Intronic
1163715413 19:18869917-18869939 CTCTCGAGGCTCGCCCTGCGAGG + Intronic
1166730065 19:45054137-45054159 TGCTCTGGGCTTGCCCAGGGAGG + Intronic
1168667941 19:58218425-58218447 ATCTCTAGGCACGCCCGGCAGGG + Intergenic
931668112 2:64624649-64624671 TTCTCAAGGCTGGCCCAGAGGGG - Intergenic
935868599 2:107419691-107419713 TTCTCTACTCTAGCCCAGGGTGG - Intergenic
946236564 2:218327852-218327874 TTCTCCTGGCTGGCCCAGAGTGG - Intronic
1173254907 20:41387356-41387378 TTCTCCAGGCTCATCCAGCTAGG - Intergenic
1173849226 20:46207397-46207419 TTCTGCAGGCTCTCCCAGGGAGG - Intronic
1176281690 20:64316983-64317005 TTCCCCAGGCTGGCCCGGCGAGG + Intergenic
1177617316 21:23539893-23539915 TCCCCTAGGCTAGCCCAGTGTGG - Intergenic
1183204304 22:36408044-36408066 TTCTCTAGGGGCGGCCAGCCTGG - Intergenic
1184471155 22:44697243-44697265 TACCCTGGGCTCCCCCAGCGTGG + Intronic
1184687342 22:46102594-46102616 TTCTCGAGGCCAGCCCAGCTGGG - Intronic
1184900892 22:47445802-47445824 TTCTCTCAGCTCCCCCAGTGGGG + Intergenic
949408514 3:3739592-3739614 TTCTCTTGGCTCGGCCTGCTTGG - Intronic
954871546 3:53771084-53771106 TTCTCCAGGCTGGCACAGCTCGG + Intronic
962405422 3:135095891-135095913 TTCCCAAGGCTCTCCCAGAGTGG + Intronic
1004452440 6:15759174-15759196 TTCTCTGGGCTGGCCGAGGGTGG - Intergenic
1019281020 7:200270-200292 CTCTCTAGGCCGGCCGAGCGAGG - Intronic
1019657108 7:2201769-2201791 TTCTCTCGCCTCTCCCTGCGGGG + Intronic
1019916583 7:4136917-4136939 GCATCTAGGCTCGGCCAGCGTGG + Intronic
1020120711 7:5501682-5501704 TTCTCTAGGCTGGTGCAGCAGGG + Exonic
1024115339 7:46187541-46187563 TTTTCTTGGCTACCCCAGCGTGG + Intergenic
1028620084 7:92815653-92815675 TTCTGTAGTCTTGCCCAGCTGGG + Intronic
1050416753 9:5426464-5426486 CTCTCTAGGCTGCCCCAGGGAGG + Intronic
1062566377 9:137165707-137165729 TTCTCTCGCCTCTCCCAGAGGGG + Intronic
1200906130 Y:8484723-8484745 TTCTCAAGGCAAGCCCAGAGAGG - Intergenic
1201125520 Y:10910492-10910514 TTCTCTAGGCTCTGCCTACGGGG - Intergenic
1201126209 Y:10917025-10917047 TTCTCTAGGCTCTGCCTGCAAGG + Intergenic
1201179213 Y:11330421-11330443 TTCTCTAGGCTCTGCCAATGGGG - Intergenic