ID: 913271438

View in Genome Browser
Species Human (GRCh38)
Location 1:117097566-117097588
Sequence CTATAGATACAGATCTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913271437_913271438 -6 Left 913271437 1:117097549-117097571 CCTTGCTTTGTATGTGTCTATAG 0: 1
1: 0
2: 1
3: 22
4: 320
Right 913271438 1:117097566-117097588 CTATAGATACAGATCTAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913271438 Original CRISPR CTATAGATACAGATCTAAGC AGG Intronic
900108164 1:994527-994549 CTAAAAATACAGATATTAGCCGG - Intergenic
902437104 1:16405338-16405360 CTAAAGATACAAAACTTAGCTGG + Intronic
903209714 1:21810678-21810700 CTATAAATACAAATATTAGCCGG - Intergenic
906384927 1:45359700-45359722 CTAAAGATACAAAAATAAGCAGG + Intronic
908220169 1:61997977-61997999 TTATATATACATATATAAGCTGG - Intronic
913015915 1:114734581-114734603 CTTTAGACTCATATCTAAGCAGG - Intronic
913271438 1:117097566-117097588 CTATAGATACAGATCTAAGCAGG + Intronic
918932061 1:190866697-190866719 ATATAAATACAGATCTAATTTGG - Intergenic
920452019 1:206066453-206066475 CTAAAAATACAGAAATAAGCTGG + Intronic
921401732 1:214731322-214731344 CTAAAAATACAGAACTTAGCTGG - Intergenic
924098166 1:240575680-240575702 CTATAAATACAGAAATTAGCTGG - Intronic
1063640689 10:7827616-7827638 CTAAAGATACAAATATTAGCTGG + Intronic
1064960714 10:20961876-20961898 CTAAAAACACAGATCTCAGCCGG + Intronic
1065056636 10:21850955-21850977 CTATACATACAGAATGAAGCAGG + Intronic
1065485902 10:26236460-26236482 CTAAAAATACAGAACTTAGCCGG - Intronic
1065902104 10:30217580-30217602 CTAAAAATACAAATCTTAGCCGG - Intergenic
1068081589 10:52324883-52324905 CTAAAAATACAAAACTAAGCCGG - Intergenic
1071026169 10:81116297-81116319 TTATACATACAGATCAAATCTGG + Intergenic
1071036173 10:81248561-81248583 ATATAGATACAGATATATGCAGG - Intergenic
1071385588 10:85117042-85117064 CTATAAATACAAAAATAAGCTGG - Intergenic
1071547670 10:86540591-86540613 CTAAAGATACAAAAATAAGCTGG - Intergenic
1071683231 10:87728576-87728598 CTAAAAATACAGATATTAGCTGG + Intronic
1072155119 10:92716902-92716924 CTCTAGATCCAGAACTCAGCAGG - Intergenic
1072336170 10:94400673-94400695 CTATACATACAGATATAAGAGGG - Intergenic
1073256424 10:102154688-102154710 CTAAAGATACAAACATAAGCTGG - Intronic
1074413780 10:113249609-113249631 CTCTAGAGACAGAGCTGAGCAGG - Intergenic
1076367434 10:129931051-129931073 ATATAGATACAGATATATGGGGG - Intronic
1078008519 11:7551022-7551044 CTATAGATATAGATATAAAGGGG - Intronic
1084415727 11:69032013-69032035 CTGTGGATAGAGCTCTAAGCAGG + Intergenic
1087677227 11:101176837-101176859 CAATAGACACAGATCCCAGCAGG - Intergenic
1088028733 11:105219781-105219803 CTATAAATACAGACATTAGCTGG + Intergenic
1088410214 11:109525920-109525942 CTAAAGATACAAACCTTAGCCGG + Intergenic
1090403291 11:126462501-126462523 CTAAAGATACAGAAATTAGCTGG + Intronic
1093649818 12:21630133-21630155 CTAAAAATACAGATATTAGCTGG + Intergenic
1094370396 12:29731316-29731338 CTAAAGATACAGAAATTAGCCGG - Intronic
1099561460 12:84181308-84181330 CTAGAGATACAGATATCAACAGG - Intergenic
1099915275 12:88885110-88885132 CTCTAGTACCAGATCTAAGCAGG + Intergenic
1100093352 12:91000053-91000075 GTATAGATACAGATATAAATAGG - Intronic
1102496769 12:113325011-113325033 CTACAGATACAGCTCTTAGATGG - Intronic
1103831926 12:123787097-123787119 ATATAGATACAGATATAGACAGG - Intronic
1104438176 12:128772838-128772860 GTATAGAAATATATCTAAGCTGG - Intergenic
1105006077 12:132721431-132721453 CTAAAAATACAGAACTTAGCTGG + Exonic
1111395260 13:87659248-87659270 CTATAAATCCATAACTAAGCAGG + Intergenic
1111554247 13:89859241-89859263 CTATAGAAACATATCACAGCAGG - Intergenic
1111990055 13:95107628-95107650 CTGTAGATAAAGATATAGGCTGG + Intronic
1112735299 13:102409325-102409347 CAAGAGATACAGATAAAAGCAGG + Intergenic
1115344458 14:32327536-32327558 TTAATGATACAGATCAAAGCTGG - Intergenic
1116455187 14:45111932-45111954 CTATAGATAAACATCTTAACCGG - Intronic
1117004842 14:51410263-51410285 CTATAGATACAGGTGAAAACAGG - Intergenic
1117579611 14:57138961-57138983 CTAAAGATACAAAAATAAGCCGG - Intergenic
1119073237 14:71608731-71608753 CTAAAAATACAGAGGTAAGCCGG + Intronic
1120509011 14:85390114-85390136 AAATAGATACAGATGTTAGCAGG - Intergenic
1120516277 14:85474907-85474929 CTATAGATCAAGGTGTAAGCAGG - Intergenic
1121085674 14:91144396-91144418 CTAAAGATACAGAAATTAGCTGG + Intronic
1122080134 14:99261333-99261355 TTATCGATACAGTTCTAAGGAGG - Intronic
1122157665 14:99759943-99759965 CTATAAATACAGAAATTAGCCGG + Intronic
1122966576 14:105130905-105130927 CTAAAGATACAAATATTAGCTGG + Intergenic
1124234504 15:27976938-27976960 CTATAGATACAGGGCTACTCAGG + Intronic
1125786771 15:42325625-42325647 CTATACATACAGAACTAAGTAGG - Intronic
1133532009 16:6663929-6663951 CTAGAGATAAAGCTCAAAGCAGG + Intronic
1133650989 16:7814473-7814495 GAAAAGATACAGATATAAGCTGG - Intergenic
1134591222 16:15455160-15455182 CTAAAGATACAGACATTAGCCGG + Intronic
1134652967 16:15925395-15925417 CTAAAGATACAGAAATTAGCCGG + Intergenic
1135887595 16:26325470-26325492 CTATAAATACAAAAATAAGCTGG + Intergenic
1135960440 16:26990394-26990416 CTAAAAATACAGAACTTAGCTGG + Intergenic
1138022847 16:53500537-53500559 CTAAAGATACAAAACTTAGCTGG - Intronic
1143542071 17:7574875-7574897 CTGTAGATGCAAATATAAGCTGG - Intronic
1145047613 17:19630352-19630374 CTAGAGATACAGAACTGAACAGG - Intergenic
1145840739 17:27992124-27992146 CTAAAGATACAAAACTTAGCCGG - Intergenic
1147492058 17:40878961-40878983 CTAAAGATACAAAAATAAGCTGG - Intronic
1147616040 17:41828496-41828518 CTAAAAATACAGAAATAAGCCGG - Intronic
1149999341 17:61423694-61423716 CTATAGATACAAAACTAGCCAGG + Intergenic
1152344814 17:79744833-79744855 CTAAAAATACAGATATTAGCTGG - Intergenic
1153492122 18:5660196-5660218 CTAAAGATACAAAACTTAGCTGG + Intergenic
1153738528 18:8098662-8098684 CTATAAATTCAGATCCAATCAGG + Intronic
1154157617 18:11956185-11956207 CTAAAGATACAAAACTTAGCCGG + Intergenic
1155901181 18:31392974-31392996 CTATAGAAAAAAATCAAAGCCGG - Intronic
1156556607 18:38075570-38075592 CCAGAGAAACAGATCTAAGAGGG + Intergenic
1157513026 18:48292034-48292056 CTATAAATACAAATATTAGCTGG + Intronic
1158804026 18:60947583-60947605 CTATAGATTTAGATAGAAGCAGG - Intergenic
1159778573 18:72633484-72633506 TTATAGATACAGTAATAAGCTGG - Intronic
1160034136 18:75285796-75285818 CTTTAAATCCAGAGCTAAGCTGG - Exonic
1161875881 19:6908970-6908992 CTACAAATACAGAACTTAGCCGG + Intronic
1162892500 19:13744027-13744049 CTATAGATACAAAAATTAGCTGG + Intronic
1167453508 19:49585916-49585938 CTAAAGATACAGAAATTAGCTGG + Intronic
1168139633 19:54376564-54376586 CTAAAAATACAAAACTAAGCTGG + Intergenic
1168553359 19:57318142-57318164 CTATAAATACAGAAATTAGCTGG - Intergenic
925311322 2:2885545-2885567 CTAAAAATACAGAACTTAGCCGG + Intergenic
926567525 2:14492989-14493011 CTTTAGCTACAGAACTGAGCAGG - Intergenic
928036254 2:27826568-27826590 CTAAAGATACAAAACTTAGCTGG - Intronic
928869917 2:35964116-35964138 CTATAGCTAGAGATTAAAGCGGG - Intergenic
929252566 2:39775611-39775633 CTATAGATACAAAAATTAGCTGG + Intronic
931735849 2:65193345-65193367 CTAAAGATACAGAAATTAGCTGG + Intergenic
935188073 2:100752148-100752170 CTAAAGATACAAAACTTAGCCGG - Intergenic
935236494 2:101143222-101143244 CTAAAAATACAAAACTAAGCTGG - Intronic
936760666 2:115777031-115777053 CTATAAACACAGATCAAGGCAGG - Intronic
937542885 2:122981199-122981221 CTGGAGATACAGATCAAATCAGG + Intergenic
940577677 2:155532339-155532361 ATATATATACATATATAAGCAGG + Intergenic
941989240 2:171538957-171538979 CTAAAGATACAGAAATTAGCCGG - Intronic
942888893 2:180963290-180963312 CTAGAGAGACAGATCTAGTCTGG - Intergenic
943013618 2:182482955-182482977 CTTTAGATACAGACATAAACAGG + Intronic
944846029 2:203668570-203668592 GAATAGATACATATCTAAGAAGG - Intergenic
946923073 2:224599303-224599325 CTAAAAATACAAAACTAAGCTGG + Intergenic
948008415 2:234630842-234630864 CTAGAGATCCAGTTCTGAGCTGG + Intergenic
1170192302 20:13656316-13656338 CTAAAGATACAGAAATTAGCTGG - Intergenic
1171304322 20:24092161-24092183 CTAAAAATACAAAACTAAGCCGG + Intergenic
1171818195 20:29807715-29807737 CTAAAGATACAAATATTAGCTGG - Intergenic
1173356452 20:42296282-42296304 CTAAAAATACAAATATAAGCTGG + Intronic
1174394195 20:50236150-50236172 CTATAGTTACAGATATATGTGGG + Intergenic
1178442568 21:32611140-32611162 CTAAAGATACAAATATTAGCTGG + Intronic
1178815150 21:35922624-35922646 ATATGAATACAGATTTAAGCGGG + Intronic
1180321635 22:11327123-11327145 CTAAAGATACAAATATTAGCTGG - Intergenic
1180333418 22:11553543-11553565 CTAAAGATACAAATATTAGCTGG + Intergenic
1181897717 22:26125538-26125560 CCATAGAAACAGGTCTCAGCAGG - Intergenic
1182160375 22:28115522-28115544 CTCTAGATACAGATTTAGCCAGG - Intronic
1182640836 22:31765859-31765881 CTAAAAATACAGAACTTAGCTGG + Intronic
1183971077 22:41477901-41477923 CTAAAAATACAGATATGAGCCGG + Intronic
1184578514 22:45395137-45395159 CTAGAGGTACAGAAATAAGCAGG + Intronic
1184905834 22:47485917-47485939 CTAAAAATACAGAACTTAGCTGG + Intronic
950977425 3:17262928-17262950 CTATACATAAAGATGTAGGCTGG + Intronic
952986566 3:38790674-38790696 CTGTAGATACTGCTCTACGCAGG + Intronic
953339034 3:42118386-42118408 ATGTAAATACAGATCTCAGCGGG - Intronic
962509127 3:136081152-136081174 CTATAAATACAAATATTAGCTGG - Intronic
964896103 3:161598272-161598294 CTAAAAATACAGAACTTAGCCGG - Intergenic
967486749 3:190041108-190041130 CTATATATATATATATAAGCTGG + Intronic
967591035 3:191273938-191273960 CTAAAGATACAAAACTTAGCCGG + Intronic
967950982 3:194840389-194840411 TTACAGATCCAGACCTAAGCAGG + Intergenic
970456595 4:16228494-16228516 CTAAAGATACAAATATTAGCCGG + Intergenic
971018506 4:22512060-22512082 CTAAAAATACAGATATTAGCTGG - Intronic
973661523 4:53112063-53112085 CTGTGGATACAGAGCTAGGCCGG + Intronic
975316148 4:72955534-72955556 CTAAAGATACAAAACTTAGCTGG + Intergenic
975502726 4:75104552-75104574 CTATAGCTACAGATCAACTCTGG - Intergenic
976165536 4:82250981-82251003 CTAAAAATACAAAACTAAGCCGG + Intergenic
977560272 4:98525664-98525686 CTATATATACAGAACTCAGGAGG - Intronic
978372780 4:108045965-108045987 CTAGAGATAGGGATCAAAGCAGG - Intergenic
979476207 4:121160315-121160337 CTAAAGATACAAATATTAGCTGG + Intronic
979904718 4:126272223-126272245 CTAAAGATACAAAAATAAGCTGG - Intergenic
981312286 4:143309070-143309092 CTAAAGATACAAAAATAAGCTGG - Intergenic
981822561 4:148902773-148902795 CTATAGTTATAGACCTAAGAGGG + Intergenic
982667958 4:158290350-158290372 CTAAAGATACAAAAATAAGCTGG - Intergenic
984997974 4:185454550-185454572 CTAAAAATACAGAAATAAGCTGG + Intronic
986160661 5:5225439-5225461 CTAAAGATACAAAACTTAGCTGG + Intronic
986604100 5:9504432-9504454 CTAGAGATGCAGAAGTAAGCAGG + Intronic
991921072 5:71657586-71657608 CTAAAAATACAGAACTTAGCTGG - Exonic
992961886 5:81964081-81964103 CTCTAGATTCAGATCAAATCAGG - Intergenic
994992370 5:107013643-107013665 CTAGAGATACATATATATGCTGG + Intergenic
997538754 5:134643613-134643635 CTATAAATACAAATATTAGCTGG - Intronic
998725358 5:145006663-145006685 CTAAAAATACAAATATAAGCTGG - Intergenic
999448486 5:151660305-151660327 CTAAAAATACAAATCTTAGCTGG + Intergenic
999985344 5:156999083-156999105 CTATAGATTCAGTTCTTTGCTGG - Intergenic
1003130623 6:3392421-3392443 CTATATAGACAGATCGATGCAGG + Intronic
1006223358 6:32514977-32514999 CTATAAATACAAAACTTAGCTGG + Intergenic
1006775060 6:36585933-36585955 CTATAAATACAGAAATTAGCTGG - Intergenic
1013550466 6:111202723-111202745 CTAAAGATACAAAAATAAGCCGG + Intronic
1013665260 6:112341217-112341239 CTAAAAATACAGATATTAGCTGG + Intergenic
1015618816 6:135107855-135107877 TTATAGATACAGCACTAAGTTGG + Intergenic
1016815989 6:148303633-148303655 CTAAAAATACAGAACTTAGCTGG + Intronic
1017159912 6:151355156-151355178 CTAAAAATACAAAACTAAGCTGG - Intronic
1019202041 6:170325677-170325699 CTAAAAATACAGATATTAGCTGG + Intronic
1022407764 7:30107905-30107927 CTAAAGATACAGAAATTAGCTGG + Intronic
1024361538 7:48473877-48473899 CGAAAGATACACATGTAAGCGGG + Intronic
1029563439 7:101319381-101319403 CTACAGATACAAAAGTAAGCCGG - Intronic
1031154852 7:118097422-118097444 CTAAAAATACAGAACTTAGCTGG + Intergenic
1036597236 8:10224974-10224996 CTATAAATACAAAAATAAGCTGG + Intronic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040737214 8:50522738-50522760 CTAAAAATACAGAAATAAGCCGG - Intronic
1048216626 8:132501506-132501528 CTAAAGATACAAAAATAAGCTGG - Intergenic
1049038616 8:140096006-140096028 CTCTTGATACAGAGCCAAGCAGG - Intronic
1049087957 8:140492759-140492781 CTAAAGATACAAAAATAAGCCGG - Intergenic
1049817101 8:144609998-144610020 TAATAGATACAGAGCTGAGCAGG + Intergenic
1050081346 9:1919165-1919187 CTTTAGATATAGAGCTGAGCGGG - Intergenic
1051235831 9:14997785-14997807 CTAAAGATACAAAACTTAGCTGG + Intergenic
1051915935 9:22207649-22207671 TAATAGATACAAATCCAAGCTGG - Intergenic
1053265459 9:36709941-36709963 CTATAGATTCTGATTTAACCCGG + Intergenic
1054806037 9:69396474-69396496 CTAAAGATACAGAAATTAGCCGG + Intergenic
1055689686 9:78816141-78816163 CTAAAAATACAGATTTAGGCGGG + Intergenic
1060955444 9:127635646-127635668 CTAAAGATACAGAAATTAGCTGG + Intronic
1061613653 9:131764905-131764927 CCACAGAAACAGAGCTAAGCAGG - Intergenic
1186035192 X:5414750-5414772 CTAAAGATACAAAACTTAGCTGG + Intergenic
1187383399 X:18825777-18825799 GTACAGATACAGATCTGACCTGG + Exonic
1187709089 X:22036219-22036241 CTAAAAATACAAATCTTAGCTGG - Intronic
1188759493 X:34009033-34009055 CTAAAGATACAGAAATTAGCAGG + Intergenic
1190092463 X:47451577-47451599 CTAAAGATACAAAACTTAGCTGG + Intronic
1200308159 X:155049597-155049619 TTATAGATACATAAATAAGCCGG - Intronic