ID: 913271622

View in Genome Browser
Species Human (GRCh38)
Location 1:117099628-117099650
Sequence TTGTTGTTTTTAAAGACAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913271622_913271627 14 Left 913271622 1:117099628-117099650 CCCCTTGTCTTTAAAAACAACAA No data
Right 913271627 1:117099665-117099687 CTGCCAATCCCCTCTCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913271622 Original CRISPR TTGTTGTTTTTAAAGACAAG GGG (reversed) Intronic
No off target data available for this crispr