ID: 913271622 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:117099628-117099650 |
| Sequence | TTGTTGTTTTTAAAGACAAG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 913271622_913271627 | 14 | Left | 913271622 | 1:117099628-117099650 | CCCCTTGTCTTTAAAAACAACAA | No data | ||
| Right | 913271627 | 1:117099665-117099687 | CTGCCAATCCCCTCTCACAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 913271622 | Original CRISPR | TTGTTGTTTTTAAAGACAAG GGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||