ID: 913273954

View in Genome Browser
Species Human (GRCh38)
Location 1:117120364-117120386
Sequence GATCGAAGGAGATCAAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913273952_913273954 1 Left 913273952 1:117120340-117120362 CCTGCTTTTCTGTAAGAGTTGCA 0: 1
1: 0
2: 0
3: 7
4: 200
Right 913273954 1:117120364-117120386 GATCGAAGGAGATCAAGAACAGG 0: 1
1: 0
2: 0
3: 16
4: 129
913273949_913273954 30 Left 913273949 1:117120311-117120333 CCAATTAATAAATGGGGGCGAAA 0: 1
1: 0
2: 0
3: 12
4: 166
Right 913273954 1:117120364-117120386 GATCGAAGGAGATCAAGAACAGG 0: 1
1: 0
2: 0
3: 16
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913273954 Original CRISPR GATCGAAGGAGATCAAGAAC AGG Intronic
901405482 1:9042119-9042141 GATCAAAGGAGCTCATGCACAGG + Intronic
901828160 1:11875964-11875986 GATCCATGGAAATCAAGAGCGGG + Intergenic
901955681 1:12783594-12783616 GATTGATGGAGTACAAGAACAGG - Intergenic
901979053 1:13019644-13019666 GATTGATGGAGTACAAGAACAGG - Intronic
902003030 1:13209294-13209316 GATTGATGGAGTACAAGAACAGG + Intergenic
902022254 1:13355058-13355080 GATTGATGGAGTACAAGAACAGG + Intergenic
906258301 1:44367386-44367408 GATAAAAGGAGAGCAAGAATGGG + Intergenic
910604145 1:89065159-89065181 GAACTAAGGAGAAAAAGAACAGG - Exonic
910635934 1:89407737-89407759 GAACTAAGGAGAAAAAGAACAGG + Intergenic
912791277 1:112653640-112653662 GATAGAAGGATATGAAGATCAGG + Exonic
913273954 1:117120364-117120386 GATCGAAGGAGATCAAGAACAGG + Intronic
919788226 1:201273832-201273854 GATCCCAGGAGATAAAGGACCGG + Intergenic
923367780 1:233279920-233279942 TATAGAAGGAGGTAAAGAACAGG - Intronic
923384201 1:233450200-233450222 GATAGAAGGGCACCAAGAACAGG + Intergenic
1062979255 10:1708265-1708287 GATCAAAGGGGATGAAGAAAAGG + Intronic
1064036801 10:11920455-11920477 GAACGAAGGACAACAAGAAGTGG - Exonic
1064415635 10:15146877-15146899 GATCCCAGGAGTTCAAGACCAGG + Intronic
1068798183 10:61107578-61107600 GAGGGAAAGAGATCAAGAAGAGG + Intergenic
1073155779 10:101345367-101345389 GAGCTAAGGAGATCAAGACCAGG - Intergenic
1078179740 11:9001511-9001533 GATAGAAGGAGTCCAAGAAAAGG - Intronic
1078483987 11:11705166-11705188 GTTCGATGGAGAAAAAGAACAGG - Intergenic
1079015014 11:16861437-16861459 GAGCTAAGGAGCTCAAGACCTGG + Intronic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1085048080 11:73364740-73364762 GATCGAAGGAGGACAGGGACTGG - Intronic
1086234100 11:84607022-84607044 GATCCAAGGTCATCAAGAGCAGG + Intronic
1088076923 11:105861121-105861143 GAGAGAACTAGATCAAGAACAGG + Intronic
1089998907 11:122936152-122936174 GATCGAAGAACACCAAGAAATGG - Intronic
1091616589 12:2054406-2054428 GTTTGAAGGAGATCATGAAAGGG + Intronic
1093289390 12:17302211-17302233 GATCGATGAGGATCAAGAACTGG + Intergenic
1100961724 12:99969395-99969417 GAGCCAAGGAGTTCAAGACCAGG - Intronic
1103349542 12:120274260-120274282 GAGCCTAGGAGTTCAAGAACAGG - Intergenic
1103645152 12:122385977-122385999 GATGGAAAGAAATCAAGAATTGG + Intronic
1104212989 12:126708230-126708252 GATGGTAGGACATCAAGATCTGG - Intergenic
1104503426 12:129308008-129308030 GCTCGAAGGAGAGAAAGAACTGG - Intronic
1105466163 13:20642714-20642736 GATCCAAGCTGATCATGAACTGG - Intronic
1105686582 13:22789179-22789201 GAGCTAAGGAGATCAAGACTTGG - Intergenic
1114608001 14:24013766-24013788 GATTGACGGAGTACAAGAACAGG - Intergenic
1115676142 14:35676961-35676983 GATCAAAGGAGAAAAAGAAAAGG + Intronic
1115759280 14:36561769-36561791 GAGCTAAAGAGATCAAGATCAGG + Intergenic
1118280756 14:64426311-64426333 GATCAAATGAGATCAAATACGGG - Intronic
1120138899 14:80904850-80904872 AAACGAATGAGATCAAGAACTGG - Exonic
1121071879 14:91030870-91030892 GATGCAAGGAGATAAACAACAGG + Intronic
1121659460 14:95624205-95624227 GAAGGAAGGAGATAAAGAATGGG + Intergenic
1124545505 15:30622854-30622876 AATAGGAGAAGATCAAGAACAGG - Intergenic
1124779022 15:32612248-32612270 AATAGGAGAAGATCAAGAACAGG - Intergenic
1125495846 15:40193061-40193083 GATCCCAGGAGTTCAAGACCAGG - Intronic
1126136861 15:45401215-45401237 GACAGAATGAGATCAGGAACTGG + Intronic
1126527157 15:49668857-49668879 ATTCTAAGGAGGTCAAGAACAGG + Intergenic
1130081890 15:80741045-80741067 GAAGGAAGGGGATCAAGACCAGG - Intronic
1130276481 15:82479205-82479227 GATCGGAGGAGACCAAGAAAGGG + Intergenic
1130468847 15:84206598-84206620 GATCGGAGGAGACCAAGAAAGGG + Intergenic
1130476337 15:84321149-84321171 GATCGGAGGAGACCAAGAAAGGG + Intergenic
1130495428 15:84466981-84467003 GATCGGAGGAGACCAAGAAAGGG - Intergenic
1130591141 15:85211197-85211219 GATCGGAGGAGACCAAGAAAGGG + Intergenic
1131638166 15:94259999-94260021 GGTTGAAGGAGATTAAGAACAGG - Intronic
1132209433 15:100009051-100009073 GATCCCAGGAGTTCAAGACCAGG - Intronic
1136355305 16:29741366-29741388 GATGGAGGCAGATCATGAACTGG + Intergenic
1139919038 16:70447385-70447407 GAGCCAAGGAGTTCAAGACCAGG + Intergenic
1140233444 16:73137460-73137482 CTTCTAAGGAGATTAAGAACGGG + Intronic
1146262774 17:31432571-31432593 GATCTCAGGAGTTCAAGACCAGG - Intronic
1148798149 17:50207308-50207330 CAAGGAAGGAGATCAAGATCTGG - Intergenic
1150071771 17:62157064-62157086 GATCCCAGGAGTTCAAGACCAGG - Intergenic
1151402711 17:73866377-73866399 GATGGAAGGAGGGCAGGAACAGG + Intergenic
1155983138 18:32201829-32201851 GGTCTAAGAAGATCAAGAACAGG - Intronic
1156658285 18:39313717-39313739 GATAGAAGGATATCAGGATCTGG - Intergenic
1161877103 19:6920181-6920203 GATCCAATCAGATCAAGACCTGG - Intronic
1164156095 19:22598240-22598262 GAGCGGAGGAGATCAAGACCAGG - Intergenic
1168385358 19:55958762-55958784 GAGCCCAGGAGATCAAGACCAGG - Intronic
927612820 2:24558868-24558890 GATCCAACGAGATCAAGCCCTGG - Intronic
930999630 2:57764778-57764800 AAGAGAAGGAAATCAAGAACAGG + Intergenic
935878855 2:107540915-107540937 ATTGGAAGGAGGTCAAGAACTGG - Intergenic
940987242 2:160062217-160062239 GGTCGAAGGAGAGGAAGAAGGGG - Intronic
943114879 2:183656092-183656114 GTTAGAAGGAGAGCAAGAATAGG - Intergenic
945039330 2:205730932-205730954 GATGGGAAGAGACCAAGAACAGG - Intronic
945958393 2:216107403-216107425 GATCCCAGGAGTTCAAGACCAGG + Intergenic
948795542 2:240400453-240400475 GATCGAAGGGGAGAAGGAACAGG + Intergenic
1169496338 20:6119159-6119181 GAGGTCAGGAGATCAAGAACAGG - Intronic
1170328069 20:15178205-15178227 GAAGGAAGGAGAGAAAGAACTGG - Intronic
1170358461 20:15518618-15518640 GATTGAAGAAGAGAAAGAACAGG + Intronic
1173623417 20:44453899-44453921 GGTGGAAGGAGAGCAGGAACTGG - Intronic
1174175814 20:48644266-48644288 AATGGAAGGAAATCAAGTACAGG + Intronic
1175229604 20:57465417-57465439 GAAGGAAGGAGATCCAGACCAGG - Intergenic
1179005510 21:37510692-37510714 GATGGTAGGAGATCAGGACCTGG - Intronic
1179019937 21:37630279-37630301 GCTCAAAGGAGATCAAGATCAGG - Intronic
1181535426 22:23540127-23540149 GATTGATGGAGTACAAGAACAGG + Intergenic
1182484178 22:30629406-30629428 GATCAATTGAGCTCAAGAACTGG + Intergenic
1182569117 22:31222966-31222988 GATGGAATGGGATCCAGAACAGG + Intronic
951441506 3:22728686-22728708 GATTGAAGGAAAGCAATAACAGG - Intergenic
951643072 3:24857699-24857721 GAGCGTAGGAGTTCAAGACCAGG + Intergenic
956162377 3:66368802-66368824 GATGCAAGGAGTTCAAGACCAGG + Intronic
959070106 3:101694114-101694136 GATTGATGGAGTACAAGAACAGG + Intergenic
959329987 3:104992561-104992583 GATCAAAGGATATAAAGAAGGGG + Intergenic
959621482 3:108402931-108402953 GATGGAAGGAGAAGAAGAGCTGG - Intronic
963950023 3:151189310-151189332 GCTAGAAGGAGAGCAAGCACTGG + Intronic
966013117 3:175106477-175106499 GAACGAATAAGATCAAGAAGTGG - Intronic
968079640 3:195837016-195837038 GGTCAAAGGAGAACAAGAAGGGG - Intergenic
968182529 3:196606963-196606985 GAGCCAAGGAGTTCAAGATCAGG - Intergenic
976118434 4:81753764-81753786 GATGGAAGGAAATCAGGGACTGG + Intronic
977421095 4:96800762-96800784 TATTGAAGGAGAAGAAGAACAGG - Intergenic
980240428 4:130166874-130166896 GATCGGAGGTGATCAGGAAAGGG - Intergenic
981867715 4:149444717-149444739 AATCGAAGGAAATAATGAACAGG + Intergenic
984767979 4:183414027-183414049 GAGTGAAGGAGACCAAGAAAGGG - Intergenic
989558686 5:42826179-42826201 GAGCTCAGGAGTTCAAGAACAGG + Intronic
990465490 5:56067604-56067626 GATGGAAGGAGATAGTGAACTGG - Intergenic
995606188 5:113858132-113858154 GAGTCCAGGAGATCAAGAACAGG - Intergenic
998864600 5:146484886-146484908 GAATGAAGGAGATCAACAATAGG - Intronic
998947469 5:147355228-147355250 GATGGAAGGTGGTGAAGAACTGG - Intronic
999752807 5:154642290-154642312 GATTGATGGAGTACAAGAACAGG - Intergenic
1000306389 5:159998435-159998457 GAACAAATGAGATGAAGAACTGG + Intergenic
1001374193 5:171239301-171239323 GATCAAGGCAGATCAAGAAGAGG + Intronic
1002151154 5:177232110-177232132 GAGCCCAGGAGTTCAAGAACAGG - Intronic
1003543307 6:7037154-7037176 GATCCCAGGAGTTCAAGATCAGG - Intergenic
1005881185 6:30062020-30062042 AAGCTAATGAGATCAAGAACTGG + Intronic
1005965045 6:30721125-30721147 GGTGGAAGGAGAATAAGAACGGG + Intronic
1006270903 6:32966819-32966841 GAGAAAAGGAAATCAAGAACAGG + Intronic
1007356314 6:41320205-41320227 GGTGGAAGGAGATGAAGATCAGG + Intergenic
1007572239 6:42901283-42901305 GATCGATGGAGTACAAGAACAGG - Intergenic
1012957493 6:105587097-105587119 GAACAAAGGAGAGCAAGAAAGGG + Intergenic
1015205624 6:130635125-130635147 GTTTAAATGAGATCAAGAACAGG + Intergenic
1015995341 6:138990588-138990610 GAGCTAAGGAGTTCAAGACCAGG + Intergenic
1022146810 7:27551839-27551861 CATCAAAAGAGATCAAGAAGAGG + Intronic
1029967115 7:104751548-104751570 GATTGATGGGGTTCAAGAACAGG - Intronic
1030166874 7:106564126-106564148 TATTGAATGAGATCAAGAGCTGG + Intergenic
1030678099 7:112405993-112406015 GAGCTAAGGAGTTCAAGACCAGG + Intergenic
1031830929 7:126624169-126624191 CATTGAAGGATATCAAGAAGAGG - Intronic
1031929538 7:127670329-127670351 GAGCCAAGGAGTTCAAGATCAGG - Intronic
1033190012 7:139269296-139269318 GATAAAATGAGAACAAGAACTGG + Intronic
1036405327 8:8449879-8449901 GCTAGAAGGAGACCAAGGACTGG + Intergenic
1036516695 8:9450887-9450909 GGTCAAAGAAGATCAAGAACTGG + Intergenic
1043206613 8:77451652-77451674 GATAGAAAGAGATAGAGAACGGG + Intergenic
1048147876 8:131863136-131863158 GTTGGAAAGAGATCAAGATCAGG - Intergenic
1049876531 8:145026521-145026543 GATTGATGGAGTACAAGAACAGG - Intergenic
1050429354 9:5546311-5546333 GAATGAAGTAGAACAAGAACAGG - Intronic
1050586402 9:7116425-7116447 GACCTTAGGTGATCAAGAACAGG + Intergenic
1052662947 9:31459279-31459301 GAGCTCAGGAGTTCAAGAACAGG - Intergenic
1056607413 9:88097756-88097778 GATGATAGGAGATCAAGAACTGG - Intergenic
1057002667 9:91527040-91527062 GATCCCAGGAGTTCAAGACCAGG + Intergenic
1057927474 9:99166097-99166119 GAGAGAAGCAGAACAAGAACAGG - Intergenic
1060057939 9:120431882-120431904 GATCAAAATAGATCAGGAACTGG - Intronic
1060644576 9:125266973-125266995 GATCACAGGAGTTCAAGACCAGG - Intronic
1187708201 X:22028047-22028069 GAGCTCAGGAGATCAAGACCAGG - Intergenic
1189282446 X:39828330-39828352 GGTCCACGGACATCAAGAACAGG + Intergenic
1192584885 X:72311724-72311746 GAGCTCAGGAGTTCAAGAACTGG - Intergenic
1193974151 X:88097028-88097050 GATAGAAGGATATGAAGATCAGG - Intergenic
1200371880 X:155735868-155735890 GATAGAAAAAGATAAAGAACCGG - Intergenic
1201275515 Y:12294135-12294157 GAGCCAAGGAGTTCAAGACCAGG - Intergenic