ID: 913274013

View in Genome Browser
Species Human (GRCh38)
Location 1:117120882-117120904
Sequence CAGGTGGACCTGCCCATGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913274013_913274016 -8 Left 913274013 1:117120882-117120904 CCACCCATGGGCAGGTCCACCTG 0: 1
1: 0
2: 1
3: 24
4: 192
Right 913274016 1:117120897-117120919 TCCACCTGAGCATCACATACAGG 0: 1
1: 0
2: 0
3: 10
4: 112
913274013_913274019 -1 Left 913274013 1:117120882-117120904 CCACCCATGGGCAGGTCCACCTG 0: 1
1: 0
2: 1
3: 24
4: 192
Right 913274019 1:117120904-117120926 GAGCATCACATACAGGACAAAGG 0: 1
1: 0
2: 0
3: 9
4: 149
913274013_913274021 28 Left 913274013 1:117120882-117120904 CCACCCATGGGCAGGTCCACCTG 0: 1
1: 0
2: 1
3: 24
4: 192
Right 913274021 1:117120933-117120955 ATCTGCGACTGCAGACTTCGTGG 0: 1
1: 0
2: 0
3: 2
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913274013 Original CRISPR CAGGTGGACCTGCCCATGGG TGG (reversed) Exonic
900743009 1:4342154-4342176 CATGTGGACCTGCCCTAGTGTGG + Intergenic
900848602 1:5123917-5123939 ACGGCGGACTTGCCCATGGGCGG - Intergenic
901213644 1:7540973-7540995 CAGGTCGACGTGCCCAGGGCAGG - Intronic
901449860 1:9329299-9329321 CAGGTGGACAGGCGGATGGGTGG + Intronic
901874814 1:12161448-12161470 CAAGTGGAGCTGCATATGGGGGG + Intergenic
902786980 1:18739039-18739061 CAGATGGACCTGGGCATAGGCGG - Intronic
903365358 1:22802472-22802494 CTGGTGGCCCTGCCAAGGGGTGG - Intronic
905344571 1:37302554-37302576 CAGGGGCCCCAGCCCATGGGAGG + Intergenic
905627802 1:39499763-39499785 CACGCGGAGCTGCACATGGGAGG - Intronic
906612725 1:47214402-47214424 CAGGTTGGCCTGACCCTGGGGGG - Intergenic
907237624 1:53062658-53062680 CAGGTGGAACTGCGTAGGGGCGG + Intronic
907310942 1:53538698-53538720 CGGGTGGGCCTGTCCTTGGGAGG + Intronic
910757517 1:90708143-90708165 CTGGTGGACATGCTCAGGGGCGG - Intergenic
912430235 1:109624966-109624988 CACGTGCACCTGCCTCTGGGAGG + Intronic
913274013 1:117120882-117120904 CAGGTGGACCTGCCCATGGGTGG - Exonic
915106360 1:153537176-153537198 CAGATGGACCCTTCCATGGGAGG - Exonic
916170801 1:162000207-162000229 CAGGTGGACCTGCCTCTGCAGGG + Exonic
919910209 1:202106504-202106526 CAGGTGCACCTGCTCCTGGGGGG - Intergenic
922899259 1:229123551-229123573 CAGGCAAACCTGCCCAGGGGAGG + Intergenic
923067165 1:230528573-230528595 CAGGTGCCCCTGCCCAATGGGGG + Intergenic
1062856311 10:781166-781188 CAGGTGGATGTTCCCATGGCTGG - Intergenic
1062932742 10:1363494-1363516 CAGGCGCACCTGGCCATGGGCGG - Exonic
1063928927 10:11009671-11009693 CAGGTTGACCCGCCCATGATTGG + Intronic
1065188905 10:23193188-23193210 CAGGCCGACCTGCCCTTGCGCGG + Exonic
1066484828 10:35833339-35833361 CAGGAGGTCCTGGCCAGGGGTGG - Intergenic
1067076959 10:43193394-43193416 CTGGAGGAACTGCCCATGGCAGG + Intergenic
1067211910 10:44266511-44266533 CAGGTGGAACAGGCCATGGTGGG - Intergenic
1067339352 10:45388459-45388481 GAGGTGTACCTGGCCATGTGGGG - Intronic
1067827754 10:49591673-49591695 CAGGTGGAGCTTCACAGGGGAGG + Intergenic
1069875876 10:71562569-71562591 GAGGAGGCCCTGCCCATGGCTGG + Intronic
1070096325 10:73340916-73340938 CAGCTGCAGCTGCACATGGGAGG + Intronic
1074438065 10:113451621-113451643 CAGGTGGCTCTCCCCATGTGGGG + Intergenic
1074974600 10:118569846-118569868 CAGCTGGTCCTAACCATGGGTGG + Intergenic
1075463247 10:122632507-122632529 CAGGTGCAACTGCACCTGGGTGG - Intronic
1076493801 10:130883588-130883610 CAGGTGGCCATTCTCATGGGAGG - Intergenic
1076745705 10:132512532-132512554 CGGGTGGACCTGGTCATTGGTGG - Intergenic
1076861386 10:133139829-133139851 CAGGGGCAGCTGCCCGTGGGTGG - Intergenic
1076912425 10:133397964-133397986 GAGGTAGACTTGCCCCTGGGTGG + Intronic
1077092628 11:786655-786677 CTGGTGGGCCTGGCCACGGGTGG - Intergenic
1077182882 11:1224389-1224411 CAGGTGGTCCAGCCCAAGGAGGG + Intronic
1077418567 11:2437385-2437407 CATGTGGACCTGCTTCTGGGTGG + Intergenic
1077536929 11:3128983-3129005 CAGGTTGCCCTGCCCACGGCCGG + Intronic
1078533730 11:12156702-12156724 CAGGTGTTCCTGCCCATGGTGGG + Intronic
1078568500 11:12437756-12437778 CAGGTTGAGCAGCCCATGTGGGG + Intronic
1081997530 11:47374995-47375017 CGGGGGGATCTGCCAATGGGTGG + Intronic
1082182578 11:49138327-49138349 CAGGTTGATCTGTCCATAGGTGG - Intergenic
1082764342 11:57155325-57155347 CAGGTGTACTGGCCCATGTGGGG - Intergenic
1083598510 11:63931902-63931924 TAGGTGGACCTGGCCTTGGGTGG + Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1084898751 11:72294300-72294322 AAGAGGGAACTGCCCATGGGTGG - Intronic
1085590293 11:77753855-77753877 CACGTGGACCTGCCAATCTGTGG + Intronic
1090635329 11:128687384-128687406 CAGGAGGCCCTGCTCATGGGAGG + Intronic
1092201054 12:6583152-6583174 CTAGTGGAACGGCCCATGGGTGG + Intronic
1097144403 12:56930003-56930025 CAGGTGGGCCTTCCCTTGAGCGG - Intronic
1098956711 12:76696026-76696048 CAGTTGGACCTGACCCTTGGGGG - Intergenic
1099390964 12:82078183-82078205 AAGGTGAACCTGCCCTTGGTTGG - Intergenic
1099680494 12:85821992-85822014 CGGGTGTACCTGCACCTGGGAGG + Intronic
1103118467 12:118359736-118359758 CAGGTGCAAGTGCCTATGGGTGG + Intronic
1104367093 12:128187692-128187714 CAGTGGGACCTGTCAATGGGAGG - Intergenic
1104429588 12:128705660-128705682 CACGTGGACCTCCCCAAGGCCGG + Exonic
1104709823 12:130977671-130977693 CAGGTGAGCCTGCCCATGCCTGG + Intronic
1106416713 13:29551854-29551876 CAGGTGCACCTTCCCAAAGGCGG - Intronic
1111919522 13:94395942-94395964 CAGTTGGATCAGCCAATGGGAGG + Intronic
1122859470 14:104576096-104576118 CAGGCAGAGCTGTCCATGGGAGG - Intronic
1123696302 15:22881450-22881472 CAGCTGGACCTGCAGATGGATGG + Intronic
1124097206 15:26659804-26659826 CTGGTGTGCCTCCCCATGGGTGG - Intronic
1128997371 15:72306805-72306827 CAGGTGGCCATGCCCAGGGACGG - Intronic
1129615847 15:77098298-77098320 CAGCTGGAGCTACCCAGGGGTGG + Intergenic
1130992191 15:88882178-88882200 CAGATGTGCCTGCCCATGGTGGG - Intronic
1131106106 15:89736034-89736056 CAGGTGGGCCAGACCATGGAAGG + Intronic
1132032048 15:98446296-98446318 GAGGTGGACCTGTCCATGGTAGG - Intronic
1132296451 15:100738311-100738333 CAGGTGGCCCTGCCGATTGGAGG + Intergenic
1132933422 16:2469887-2469909 CAGGAGGGCCTGACCATGGAGGG - Intergenic
1133279575 16:4657505-4657527 CAGGTGGACGTGTGGATGGGCGG + Intronic
1134342924 16:13361667-13361689 CAGGTGGAACAGCACATGAGTGG - Intergenic
1134622036 16:15696770-15696792 CAGGTGGCCCAGCCTCTGGGCGG + Exonic
1135107303 16:19661491-19661513 CAGGTGGACATCCCAGTGGGAGG + Intronic
1136081128 16:27853244-27853266 CAGGTGTACCTGGCCACGTGGGG - Intronic
1137722172 16:50633633-50633655 CAGGTGGCCCTGTCCTGGGGCGG + Exonic
1138482206 16:57310951-57310973 CAGGTGGGTCTGCCCAGGGGAGG + Intergenic
1139514867 16:67446990-67447012 CAGGGGGCCCTGGTCATGGGTGG - Intronic
1139594184 16:67948612-67948634 CAGCTGGCCCTGCCCATGCGTGG - Intronic
1140234039 16:73142503-73142525 AGGGTGGCCCTGCCGATGGGGGG - Intronic
1141652975 16:85403349-85403371 CTGGTGGTCATGCCCCTGGGTGG - Intergenic
1141895938 16:86958863-86958885 CTGGTGGTCTTGCCCTTGGGGGG - Intergenic
1142230985 16:88900224-88900246 CAGCTGTACCTGCCTCTGGGCGG + Intronic
1142639247 17:1276167-1276189 GGAGTGGACCTGCCCATGAGGGG - Intergenic
1145834059 17:27940412-27940434 CAAGTGGTCCTGCCCATCTGAGG - Intergenic
1146156122 17:30525215-30525237 CAGGCGAACTTGCTCATGGGTGG + Exonic
1146694430 17:34897957-34897979 CTGGGGGCCTTGCCCATGGGTGG - Intergenic
1146915156 17:36673609-36673631 GAGGTGGACTTGACCCTGGGAGG + Intergenic
1147579366 17:41619606-41619628 CTGGTGGACCTGCTCGCGGGAGG + Exonic
1147936555 17:44014647-44014669 AGGGCGGTCCTGCCCATGGGAGG - Intronic
1148984810 17:51612163-51612185 CAGGTGGCCCTCCCCTTGTGAGG + Intergenic
1149413088 17:56429063-56429085 CAAGAGGATCTGCCCATGGTAGG - Intronic
1149654761 17:58304466-58304488 CAGGTGGCCCTGCGCAGGGGTGG + Intronic
1151701313 17:75743989-75744011 CAGGTGGACGTGTCCTTGGGAGG - Intronic
1152735271 17:81994179-81994201 CAGCTGGACCCGTGCATGGGTGG - Intronic
1153017364 18:596324-596346 CAAGTGGGCCTGCCCATGCCAGG - Intergenic
1153769417 18:8403203-8403225 CAGGTGGAACTGCAACTGGGTGG - Intronic
1158920443 18:62186576-62186598 GAGGTGGTCCTGCCTGTGGGTGG - Intronic
1160622725 18:80181858-80181880 CCGGTAGACCTGTCCCTGGGAGG + Intronic
1160787713 19:908989-909011 CAGATGAACCAGCCCTTGGGAGG - Intronic
1161160803 19:2761003-2761025 CAGGTGGACCTCCCGATGCCCGG - Intronic
1162451445 19:10757475-10757497 CAGGTGGCCCTACCCATGCTGGG - Intronic
1163534477 19:17869289-17869311 CAGGTGGACCCACCCCAGGGTGG - Intergenic
1165247199 19:34504594-34504616 CAAGTGGAACTGCTCTTGGGGGG + Exonic
1167000068 19:46740623-46740645 CAGGCTGAACTGCCCCTGGGAGG - Intronic
925491729 2:4402375-4402397 CAGGCTGACCTGCCTAAGGGTGG - Intergenic
927177629 2:20421771-20421793 GAAGTGGAGCTGCCCAAGGGAGG + Intergenic
929551482 2:42895877-42895899 CAGGTGGGCCTGCCCAGGAATGG - Intergenic
931006037 2:57850569-57850591 CATATGGCCCTGCCCAGGGGTGG + Intergenic
931715233 2:65023600-65023622 CAGGTGGCCCTTCCCCTTGGAGG + Exonic
932597137 2:73101108-73101130 CAGGTGGGCCTCCCCAGGTGAGG + Intronic
935118208 2:100157033-100157055 GAGGAGTACCTGGCCATGGGAGG + Intergenic
936460097 2:112707615-112707637 CTGGAGCACCTTCCCATGGGAGG + Intergenic
938638083 2:133250513-133250535 CAGGTGGCCCTGCCCTCGGCTGG - Intronic
939172198 2:138709219-138709241 CAGGGGCAGCTGCCCAGGGGAGG + Intronic
944442288 2:199754431-199754453 CTGGTGGCCCTGCAGATGGGAGG + Intergenic
946670604 2:222099762-222099784 CAGGTGAAACTGACCATTGGCGG + Intergenic
947463965 2:230325316-230325338 CAGGTGGACATGCCCTTGCTAGG - Intergenic
948360047 2:237413445-237413467 CACCAGGACCTTCCCATGGGCGG + Intronic
1170745734 20:19097479-19097501 AAGCTGGGACTGCCCATGGGTGG + Intergenic
1172808360 20:37629512-37629534 CAGGTGTGCCTGCCAGTGGGAGG + Intergenic
1173730197 20:45322994-45323016 CAGGTGCTCCTGCCCCTGGGTGG + Intergenic
1174358356 20:50012979-50013001 CAGGTGGACCTGCCCTGGGCTGG + Intergenic
1174560786 20:51429275-51429297 CCAGGGGACCTGCCCATTGGAGG + Intronic
1175735367 20:61382445-61382467 CAGGAACACCTGCTCATGGGAGG - Intronic
1178945943 21:36947772-36947794 CAGGTGGCCCTGCCCAACAGGGG + Exonic
1181610395 22:24007771-24007793 CAGCTGGAGCTGCCCAGGTGGGG - Intergenic
1182520255 22:30881000-30881022 CAGGTGGGGCTGCCCCAGGGCGG + Intronic
1183365185 22:37403189-37403211 CAGGTGCACCTGCCTGGGGGTGG - Intronic
1183633147 22:39045605-39045627 CAGGAGGGCCTGGCCAGGGGAGG - Intronic
1183745209 22:39687985-39688007 CAGGGGGGCCTGCCAAGGGGGGG + Exonic
1184487391 22:44788497-44788519 CAGGAGGACTTGCACTTGGGAGG - Intronic
1185086624 22:48744346-48744368 GAGGTGAAGCTGCCCAAGGGTGG - Intronic
1185114575 22:48924549-48924571 CAGGTGGCCCTCCCCAGGGTGGG + Intergenic
1185155679 22:49192107-49192129 CAGGTGTTCCTGGCAATGGGTGG - Intergenic
952289755 3:32003706-32003728 CAGGTGGACCTGGGCATCGGAGG + Intronic
953454852 3:43033114-43033136 CTGTAGCACCTGCCCATGGGCGG - Exonic
954450500 3:50569051-50569073 CGGGTGGAGCTGTGCATGGGCGG - Intronic
957282576 3:78172574-78172596 CAGATGGACCTGTGCCTGGGTGG - Intergenic
966065170 3:175812670-175812692 CAGTTGGATCTGCCAATGAGAGG - Intergenic
966883742 3:184363212-184363234 CAGGTGGCTCTGCCCAGGGCGGG - Intronic
966930590 3:184673092-184673114 CTGGTGGACCTGCAGTTGGGCGG + Intronic
967085751 3:186093666-186093688 CAGGTTGACCGGCCCAAGTGTGG + Intronic
968100947 3:195965003-195965025 CAGTTGGCCCAGCCCATGGGAGG + Intergenic
968199387 3:196739749-196739771 CGCGCGGGCCTGCCCATGGGAGG + Intergenic
968433405 4:572753-572775 CAGGTGGACCTGCCCGGGGGTGG - Intergenic
969167736 4:5331254-5331276 GTGGTGGACCTGCTCCTGGGAGG + Exonic
969499019 4:7541965-7541987 CAGGGGGTCCTGCACATGGCTGG - Intronic
978795169 4:112701589-112701611 CAGGTGCACGTGACCATGGCTGG - Intergenic
983989109 4:174096890-174096912 CAGGTGGACATGCCCCAGGCTGG - Intergenic
985290340 4:188380241-188380263 CAGGTGCACCAGGACATGGGTGG + Intergenic
985502140 5:254912-254934 CAGTTGGCCCAGCCCGTGGGAGG - Intronic
985509038 5:301615-301637 CAGGTGCACCTGCCTTTGTGGGG + Intronic
985509055 5:301710-301732 CAGGTGCACCTGCCTTTGTGGGG + Intronic
985509162 5:302415-302437 CAGGTGCACCTGCCTTTGTGGGG + Intronic
985509213 5:302717-302739 CAGGTGCACCTGCCTTTGTGGGG + Intronic
985509230 5:302809-302831 CAGGTGCACCTGCCTTTGTGGGG + Intronic
985685255 5:1278656-1278678 CTTGCGGACGTGCCCATGGGCGG + Exonic
985717992 5:1473421-1473443 CAGGTGGCCCTGAACATGGCGGG - Intronic
985734880 5:1573755-1573777 CAGTTGGCCCAGCCCGTGGGAGG + Intergenic
985739048 5:1604104-1604126 CAGGTGCACCTGCCTTTGTGGGG - Intergenic
985739066 5:1604199-1604221 CAGGTGCACCTGCCTTTGTGGGG - Intergenic
991502393 5:67289924-67289946 CAGCTGGGCCTGCCCCAGGGAGG - Intergenic
997338447 5:133123933-133123955 AAGATGGAGCTGCCCATGGGTGG + Intergenic
997527635 5:134563617-134563639 CAGGTGGCCCTGTCCATAAGTGG + Intronic
997579011 5:135005540-135005562 GAGCTGGACCTGCCCATGGTCGG + Intronic
997583076 5:135029248-135029270 CAGCTGGACCTGTGCAAGGGTGG - Exonic
998199441 5:140107928-140107950 GAGCCGGACTTGCCCATGGGAGG + Intronic
999691206 5:154147370-154147392 AGGGTGGACCTGCTCATGAGTGG + Intronic
1003188300 6:3851381-3851403 AAGGTGGACCTGCCCATCACTGG + Intergenic
1006523871 6:34587930-34587952 CAGGTGGTCCTGCCCAGAGGTGG + Exonic
1007752287 6:44077608-44077630 CATGGGGACCTGCCCAGGCGAGG + Intergenic
1009699011 6:67150977-67150999 CAAATGGACCAGTCCATGGGAGG + Intergenic
1012925561 6:105263702-105263724 CAGGAGGACCTGGTCATGTGGGG + Intergenic
1016737260 6:147492794-147492816 GAGGAGGACCTGGCCTTGGGTGG - Intergenic
1017225065 6:152011671-152011693 AAGGTGGACCTGATCATGGAGGG - Exonic
1018198956 6:161378145-161378167 CACGTGGACAGACCCATGGGAGG + Intronic
1019701031 7:2475153-2475175 CAGGTGGAGCTGGCCAAGAGGGG - Exonic
1022388601 7:29924473-29924495 CAGGTGGCCCTGCCCTCTGGAGG + Intronic
1023452505 7:40302917-40302939 CAGGTGGAGATGCCTATGAGTGG - Intronic
1023635226 7:42202982-42203004 AAGGAGGAGCTGACCATGGGAGG + Intronic
1023873631 7:44275742-44275764 TAGGTGGCCCTCCCCCTGGGAGG + Intronic
1024086460 7:45895549-45895571 CCTTTGGACCTGCCCATGGTGGG + Intergenic
1027436281 7:78167944-78167966 GAGGTTGACCTGCCCATTGCGGG + Exonic
1031182454 7:118435369-118435391 CAAGAGGACCTGCCCATTTGAGG - Intergenic
1032476363 7:132214109-132214131 GAGGTGGTCCTGCCCACTGGTGG - Intronic
1035596793 8:864730-864752 CAGGTGCACCTGTCGATGGGAGG + Intergenic
1035908350 8:3538376-3538398 CAGGTGCACCAGCCCAGGTGTGG - Intronic
1036225574 8:6954831-6954853 CAGGTGGCCCTGCCAATGCCAGG - Intergenic
1037575531 8:20198354-20198376 CAGGTGGCTTTGCCCATAGGTGG + Intronic
1039381132 8:37086418-37086440 CAGGTAGACCTGTACATGGGAGG - Intergenic
1048229151 8:132620207-132620229 CAGGAGGACCAGCCCAAGAGTGG + Intronic
1049094813 8:140542173-140542195 GAGGTGGCCCAGCCCATGGAGGG + Intronic
1049362607 8:142219513-142219535 CAGGTGGACCCGGCCAGGTGGGG + Intronic
1049549700 8:143251379-143251401 CCTGTGGACCTGCCACTGGGTGG - Intronic
1049837887 8:144750674-144750696 CAGGGGGACCCGGTCATGGGAGG - Intronic
1054854540 9:69884489-69884511 CTGGTGGTCCTGCTCCTGGGAGG + Intronic
1054924514 9:70576108-70576130 CAGGTGAATCTCCTCATGGGCGG + Intronic
1056217351 9:84417585-84417607 CAGCTGGACTTTTCCATGGGGGG + Intergenic
1056396359 9:86185140-86185162 CATGTGCACCTGCCCATGTGAGG + Intergenic
1058115926 9:101084153-101084175 CAGGTGGTCCTAGCCATTGGAGG + Intronic
1058572197 9:106358836-106358858 AAGGTGGTCTTGCCCGTGGGAGG - Intergenic
1058889730 9:109351077-109351099 CAGCTGGACATGAACATGGGAGG + Intergenic
1060221369 9:121765764-121765786 CAGGTGGGCCTGACCATGGCAGG + Intronic
1060903109 9:127279053-127279075 CAGGTGGACCTGAATTTGGGGGG + Intronic
1061026953 9:128055862-128055884 CAGCTGGACCTGCCCCTCTGGGG - Intergenic
1061209208 9:129181142-129181164 CACGAGGAGCTGCCCATGTGAGG - Intergenic
1061259644 9:129472793-129472815 CAGATGGACCAGCCGATGGGGGG + Intergenic
1061561410 9:131406264-131406286 CTGATGCACCTGCCCATGGGAGG - Intronic
1062034608 9:134377353-134377375 CAGGTGGCCCAGAGCATGGGAGG + Intronic
1062424245 9:136498676-136498698 CAGCTGGACCTGCACTTGGAAGG + Intronic
1062467550 9:136687771-136687793 CAGGAGGCCCAGACCATGGGGGG - Intergenic
1187848442 X:23566030-23566052 GAGGGGTACCTGGCCATGGGAGG + Intergenic
1192152447 X:68720532-68720554 CTGGTGGACCAGCCCAAGTGAGG - Intronic
1195826141 X:109003495-109003517 CAGTTGGAGCAGCCCATGGAGGG + Intergenic