ID: 913274319

View in Genome Browser
Species Human (GRCh38)
Location 1:117122362-117122384
Sequence CCCGAAAAATACCCAAAGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913274319_913274333 28 Left 913274319 1:117122362-117122384 CCCGACTTTGGGTATTTTTCGGG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 913274333 1:117122413-117122435 GGGACCGGTTCGGGAGACCGTGG 0: 1
1: 0
2: 0
3: 13
4: 133
913274319_913274331 18 Left 913274319 1:117122362-117122384 CCCGACTTTGGGTATTTTTCGGG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 913274331 1:117122403-117122425 TCGCGTTACGGGGACCGGTTCGG 0: 1
1: 0
2: 0
3: 1
4: 4
913274319_913274326 -6 Left 913274319 1:117122362-117122384 CCCGACTTTGGGTATTTTTCGGG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 913274326 1:117122379-117122401 TTCGGGGGTGAGGGCATCTCAGG 0: 1
1: 0
2: 0
3: 5
4: 109
913274319_913274329 8 Left 913274319 1:117122362-117122384 CCCGACTTTGGGTATTTTTCGGG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 913274329 1:117122393-117122415 CATCTCAGGCTCGCGTTACGGGG 0: 1
1: 0
2: 0
3: 1
4: 14
913274319_913274330 13 Left 913274319 1:117122362-117122384 CCCGACTTTGGGTATTTTTCGGG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 913274330 1:117122398-117122420 CAGGCTCGCGTTACGGGGACCGG 0: 1
1: 0
2: 0
3: 1
4: 26
913274319_913274332 19 Left 913274319 1:117122362-117122384 CCCGACTTTGGGTATTTTTCGGG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 913274332 1:117122404-117122426 CGCGTTACGGGGACCGGTTCGGG 0: 1
1: 0
2: 0
3: 0
4: 10
913274319_913274327 6 Left 913274319 1:117122362-117122384 CCCGACTTTGGGTATTTTTCGGG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 913274327 1:117122391-117122413 GGCATCTCAGGCTCGCGTTACGG 0: 1
1: 0
2: 0
3: 0
4: 32
913274319_913274328 7 Left 913274319 1:117122362-117122384 CCCGACTTTGGGTATTTTTCGGG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 913274328 1:117122392-117122414 GCATCTCAGGCTCGCGTTACGGG 0: 1
1: 0
2: 0
3: 2
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913274319 Original CRISPR CCCGAAAAATACCCAAAGTC GGG (reversed) Intronic
900628201 1:3619226-3619248 CCCAAGAAATACACAAACTCAGG + Intergenic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
906861731 1:49368042-49368064 CCTGAAAAATATGCAAAGTGAGG - Intronic
908458338 1:64325833-64325855 CCCGTAAAATAAGCAAAGCCAGG + Intergenic
910478098 1:87629309-87629331 CCTGACAAATACCCAAAGCTAGG + Intergenic
910703882 1:90105728-90105750 TCATAAAAATACCCCAAGTCAGG + Intergenic
911219328 1:95230684-95230706 CTCCAAAAGTACACAAAGTCTGG - Intronic
913274319 1:117122362-117122384 CCCGAAAAATACCCAAAGTCGGG - Intronic
923699541 1:236286663-236286685 ACCCAAATAAACCCAAAGTCTGG - Intergenic
1066021246 10:31304799-31304821 CCCATGACATACCCAAAGTCTGG + Intergenic
1068626427 10:59253399-59253421 CTCCAGAAATACCCCAAGTCAGG + Intronic
1075639993 10:124057597-124057619 CCAGAAAAATGCCCACATTCGGG + Intronic
1077875564 11:6302181-6302203 CACGGAAAAGACCCAAATTCGGG + Intergenic
1085298614 11:75445350-75445372 AGAGAAATATACCCAAAGTCAGG - Intronic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1093040316 12:14371388-14371410 CTTGAAAAAGACCCAAAGGCAGG - Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1105531030 13:21220643-21220665 ACTGAAAACTTCCCAAAGTCAGG - Intergenic
1112693244 13:101918194-101918216 CCCGAAAAAAACAAAAAGCCGGG + Intronic
1114168366 14:20245147-20245169 CCAGAAAAGTATCCATAGTCAGG - Intergenic
1116973194 14:51089800-51089822 CCAGAAAAGTACCCCAAGTTGGG + Intronic
1123890749 15:24776039-24776061 CCAGAAAAATATGCAAGGTCTGG + Intergenic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1137660195 16:50199017-50199039 CCCCAAAAAGAATCAAAGTCAGG - Intronic
1140862311 16:79028616-79028638 CCCAAAACATACCCTAATTCAGG - Intronic
1155212142 18:23611281-23611303 CCCTAAAAATGCCAAAATTCTGG - Intronic
1157508915 18:48253715-48253737 TCAGGAAAATACCCAAAGCCAGG + Intronic
1161653813 19:5500879-5500901 CCCGAAAACTACCCACTGTGGGG - Intergenic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
925376745 2:3391496-3391518 CCCGTAAAACACCCAAAATACGG - Intronic
932733017 2:74233656-74233678 CTTGAAAAGTACCCAAAGTCAGG - Intronic
1168737285 20:152151-152173 CCTGAAAAATATCCCAAGTGTGG + Intergenic
1170513964 20:17108629-17108651 ACCAAAAAATCCACAAAGTCTGG - Intergenic
1182588808 22:31363287-31363309 CTTGAAAAAGGCCCAAAGTCAGG + Intergenic
1182589002 22:31364518-31364540 CTTGAAAAAGGCCCAAAGTCAGG - Intergenic
951613123 3:24514025-24514047 CCCGAAAAATCACAAAAATCAGG - Intergenic
954768360 3:52942493-52942515 AAAGAAAAATACCAAAAGTCTGG + Intronic
956778091 3:72582836-72582858 ACCGAAAAAAACAAAAAGTCTGG + Intergenic
965617303 3:170607808-170607830 CCAAAAAAATACCCAGAATCTGG - Intronic
967428493 3:189354770-189354792 CCAGAAACATCCCCATAGTCTGG + Intergenic
968564957 4:1306975-1306997 CCAGAAAAAGACCCACAGGCAGG - Intronic
970872746 4:20834788-20834810 CCAGAGAAATAACCAAATTCTGG - Intronic
974110335 4:57518423-57518445 ACCCAAAAAAACCCAAAGACTGG + Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
986468615 5:8051704-8051726 CCAGAATAAGACTCAAAGTCAGG - Intergenic
986915506 5:12614799-12614821 CCAGAAGTATACTCAAAGTCTGG - Intergenic
988945737 5:36196442-36196464 ACAGAAAAATGGCCAAAGTCAGG - Intronic
991721173 5:69494926-69494948 CCAGAAAAATTCCCCAAATCTGG - Intronic
993210977 5:84951072-84951094 CCCTAAAAATTCCTAAAGTAGGG + Intergenic
995962157 5:117855092-117855114 CCCCAAAAATACCCACAGAAAGG - Intergenic
1004336724 6:14770884-14770906 CACAAAAAATACACAAAGTCTGG + Intergenic
1005600105 6:27417997-27418019 CCTGAAAAATACCCAGTTTCTGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006165120 6:32059887-32059909 CTCGAAAAATACTCTAAGCCAGG + Intronic
1006286058 6:33095314-33095336 CAAGAAAAGTACACAAAGTCAGG + Intergenic
1006908081 6:37546252-37546274 CCAGAAGAACAGCCAAAGTCAGG - Intergenic
1008740633 6:54603119-54603141 AACAAAACATACCCAAAGTCTGG - Intergenic
1011010825 6:82702173-82702195 CCAGACAAATTCCCAAAGGCAGG + Intergenic
1023090939 7:36616775-36616797 TCCGAAATATACCCAAATTTTGG + Intronic
1023948038 7:44819186-44819208 CCCCAAAAATACTGAAATTCAGG - Intronic
1031548078 7:123075090-123075112 ACCAAAAATTACCCAAACTCTGG - Intergenic
1038327439 8:26582648-26582670 GTCCAAAAATACCCAAACTCAGG - Intronic
1039987171 8:42457437-42457459 TCCGCAAATCACCCAAAGTCTGG + Intronic
1040072983 8:43203480-43203502 ACCAAAAAATACAAAAAGTCAGG + Intergenic
1046317664 8:112528611-112528633 CCCCAAAAAAACACAAATTCAGG + Intronic
1051983194 9:23048859-23048881 GCTGAAAAATCCCCAAAGTGTGG + Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1186455055 X:9704127-9704149 CCTGAGAAAGGCCCAAAGTCAGG + Intronic
1187596670 X:20780526-20780548 CCTGAAAAAGACACAAAGGCTGG + Intergenic
1187749602 X:22447287-22447309 CCTGGAACATCCCCAAAGTCTGG + Intergenic
1190055632 X:47179658-47179680 CCCGACACACCCCCAAAGTCAGG - Intronic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic