ID: 913275993 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:117138192-117138214 |
| Sequence | CAGCATGTAGAGATGGCGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 913275993_913275998 | 4 | Left | 913275993 | 1:117138192-117138214 | CCTTCCGCCATCTCTACATGCTG | No data | ||
| Right | 913275998 | 1:117138219-117138241 | AATGGAATGCATGAACGCCCTGG | 0: 1 1: 0 2: 0 3: 6 4: 76 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 913275993 | Original CRISPR | CAGCATGTAGAGATGGCGGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||