ID: 913275993

View in Genome Browser
Species Human (GRCh38)
Location 1:117138192-117138214
Sequence CAGCATGTAGAGATGGCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913275993_913275998 4 Left 913275993 1:117138192-117138214 CCTTCCGCCATCTCTACATGCTG No data
Right 913275998 1:117138219-117138241 AATGGAATGCATGAACGCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913275993 Original CRISPR CAGCATGTAGAGATGGCGGA AGG (reversed) Intergenic
No off target data available for this crispr