ID: 913280274

View in Genome Browser
Species Human (GRCh38)
Location 1:117178875-117178897
Sequence ATTCATAAGGCTGGGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913280274_913280282 21 Left 913280274 1:117178875-117178897 CCACCACACCCAGCCTTATGAAT No data
Right 913280282 1:117178919-117178941 GCCCTGTGTATTCCATCCCTGGG 0: 1
1: 0
2: 1
3: 14
4: 152
913280274_913280279 -2 Left 913280274 1:117178875-117178897 CCACCACACCCAGCCTTATGAAT No data
Right 913280279 1:117178896-117178918 ATGTTTTCTAAGTGAGCACGTGG 0: 1
1: 0
2: 0
3: 7
4: 108
913280274_913280281 20 Left 913280274 1:117178875-117178897 CCACCACACCCAGCCTTATGAAT No data
Right 913280281 1:117178918-117178940 GGCCCTGTGTATTCCATCCCTGG 0: 1
1: 0
2: 1
3: 17
4: 142
913280274_913280280 -1 Left 913280274 1:117178875-117178897 CCACCACACCCAGCCTTATGAAT No data
Right 913280280 1:117178897-117178919 TGTTTTCTAAGTGAGCACGTGGG 0: 1
1: 0
2: 0
3: 5
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913280274 Original CRISPR ATTCATAAGGCTGGGTGTGG TGG (reversed) Intronic
No off target data available for this crispr