ID: 913281637

View in Genome Browser
Species Human (GRCh38)
Location 1:117190509-117190531
Sequence CTTGTTATCAGGTGTGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913281637_913281642 12 Left 913281637 1:117190509-117190531 CCATACACACACCTGATAACAAG No data
Right 913281642 1:117190544-117190566 AGACCCAACTGCAGATCCTGAGG 0: 1
1: 0
2: 2
3: 19
4: 270
913281637_913281645 23 Left 913281637 1:117190509-117190531 CCATACACACACCTGATAACAAG No data
Right 913281645 1:117190555-117190577 CAGATCCTGAGGCAGACCTTTGG 0: 1
1: 0
2: 2
3: 29
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913281637 Original CRISPR CTTGTTATCAGGTGTGTGTA TGG (reversed) Intronic
No off target data available for this crispr