ID: 913281918

View in Genome Browser
Species Human (GRCh38)
Location 1:117193781-117193803
Sequence CAGCAGCAATAAATGGTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913281913_913281918 8 Left 913281913 1:117193750-117193772 CCTAATAGACATAGAACATTCCA 0: 1
1: 0
2: 3
3: 31
4: 252
Right 913281918 1:117193781-117193803 CAGCAGCAATAAATGGTACTGGG 0: 1
1: 0
2: 0
3: 9
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913281918 Original CRISPR CAGCAGCAATAAATGGTACT GGG Intronic
901015506 1:6227402-6227424 CATCAGCAATGCATGGTCCTTGG - Intronic
903649121 1:24912342-24912364 CAGCAGGAAGAAGTGGTAGTGGG - Intronic
904269371 1:29339467-29339489 CAGAAGCAATAAATGGCAACTGG + Intergenic
906189587 1:43888019-43888041 CAGCTGCAATCAATGATACAAGG + Intronic
907236683 1:53055760-53055782 CAGCATCAATAACTGTTTCTCGG + Intergenic
907665585 1:56431380-56431402 TAGCAGCAAGGTATGGTACTGGG - Intergenic
908728514 1:67202122-67202144 CAACAGGAATCATTGGTACTGGG - Intronic
909908851 1:81235418-81235440 TGGCAGCAATAAATAGTAGTTGG - Intergenic
912068060 1:105771346-105771368 CAGCAGAAATAAAATTTACTTGG + Intergenic
912090329 1:106065641-106065663 TACCTTCAATAAATGGTACTGGG + Intergenic
912094193 1:106119275-106119297 CAGAACCAATAAAAGGTCCTTGG + Intergenic
912314429 1:108654115-108654137 CCTCCTCAATAAATGGTACTGGG - Intronic
912554656 1:110507555-110507577 CAGCAACAATAAATAATACCAGG - Intergenic
912595166 1:110868473-110868495 CATACTCAATAAATGGTACTGGG + Intergenic
913281918 1:117193781-117193803 CAGCAGCAATAAATGGTACTGGG + Intronic
919268910 1:195312939-195312961 CATATTCAATAAATGGTACTGGG - Intergenic
919508915 1:198435875-198435897 CATCTTCAATAAATGGTTCTAGG - Intergenic
921614735 1:217253117-217253139 CAGCAGCAATAAAAAATACACGG - Intergenic
1064917294 10:20474122-20474144 CAGGAAAAATAATTGGTACTAGG + Intergenic
1065411332 10:25432326-25432348 CATCAGCAATAGATGGGAGTAGG - Intronic
1068593702 10:58878047-58878069 CTTCTTCAATAAATGGTACTTGG - Intergenic
1068888162 10:62119040-62119062 CCTCATCAATAAATGGTATTGGG - Intergenic
1070127491 10:73633960-73633982 CCCCAGCAAAAAATGGAACTTGG - Exonic
1070473275 10:76805741-76805763 CACCTGGAATAAATGATACTTGG + Intergenic
1071736717 10:88309158-88309180 CAGGAGAAATAATGGGTACTAGG + Intronic
1073341323 10:102746878-102746900 CATCAGAAATAAATGATACTAGG + Intronic
1074473079 10:113744784-113744806 GAGCAGCAAGAAATGGTGGTGGG - Intergenic
1074900606 10:117813316-117813338 CAGGAGGAATAATTGGCACTTGG - Intergenic
1078087763 11:8244322-8244344 CTGCAGCAATAAAGCGTACCTGG + Intronic
1079154516 11:17932431-17932453 AAGGAGCAATAAATGTTCCTGGG + Intronic
1079762798 11:24352407-24352429 TAGAATCAATAAATGGTGCTGGG - Intergenic
1080018432 11:27532518-27532540 CAGCAGGAATAGCTGGTGCTTGG - Intergenic
1080309428 11:30872222-30872244 CAACAACAAAAAATGGCACTAGG - Intronic
1084480867 11:69419293-69419315 CAGCAGGAAGAAATGGTGCCAGG + Intergenic
1085859852 11:80220097-80220119 CATCTTCAATAAATGGTGCTGGG + Intergenic
1087378761 11:97377991-97378013 CATAATCAATAAATGGTGCTGGG - Intergenic
1087405701 11:97727334-97727356 CAGGTTCAATAAATGGTGCTGGG + Intergenic
1087633704 11:100679702-100679724 CTGCAACATTAAATGGAACTGGG + Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1091060839 11:132460568-132460590 CAGCAGCAAAAATTGATGCTTGG + Intronic
1093119338 12:15249357-15249379 GAGCAGAAATAAATGAAACTGGG + Intronic
1093130632 12:15387688-15387710 CAGCAGAAATATATAGTACCAGG - Intronic
1094614636 12:32025150-32025172 CAGTAGCAATAAATAGCACCAGG + Intergenic
1095224338 12:39661883-39661905 CACCTTCAATAAATGGTGCTGGG - Intronic
1096111723 12:49032712-49032734 CAGCAGCAGCAAGTGGCACTTGG - Exonic
1098582542 12:72117309-72117331 CCTCTTCAATAAATGGTACTGGG - Intronic
1099917273 12:88910299-88910321 CATCATCAGTAAATGGTGCTGGG - Intergenic
1101935917 12:109056735-109056757 CAGCAGGAATATATGTTATTTGG + Exonic
1108270853 13:48758054-48758076 CAGCAGCTATAAGTGATACTGGG - Intergenic
1108635517 13:52330809-52330831 CCTCTTCAATAAATGGTACTAGG + Intergenic
1108652289 13:52492427-52492449 CCTCTTCAATAAATGGTACTAGG - Intergenic
1108898774 13:55370402-55370424 AAGCAGTAATGAATTGTACTAGG + Intergenic
1110501787 13:76236962-76236984 CAGTCTCAATAAATGGTGCTTGG + Intergenic
1110906762 13:80899205-80899227 AAACAGCAATAAATGGGGCTGGG + Intergenic
1112066655 13:95800129-95800151 CTGGAGCAGTAAATGGTCCTGGG - Intergenic
1112787025 13:102962275-102962297 AAGCAGCAATAAATGAGATTTGG + Intergenic
1114690889 14:24580079-24580101 TATCCCCAATAAATGGTACTGGG + Intergenic
1115485972 14:33911641-33911663 CAGCACCAATAAATGAGACATGG - Intergenic
1117750844 14:58922239-58922261 GACCATCAATAAATGGTGCTGGG + Intergenic
1120423774 14:84321310-84321332 CATCTTCAATAAATGGTGCTGGG + Intergenic
1121763700 14:96467308-96467330 CAGCAGCAAAAGATGGCTCTTGG - Intronic
1122617050 14:103025966-103025988 CAGCATCTTCAAATGGTACTGGG + Intronic
1123922877 15:25082893-25082915 CTGCAGCAACAAATGAAACTTGG - Intergenic
1126872518 15:53004810-53004832 CCACAGCAATAGATGGCACTGGG - Intergenic
1127320017 15:57834899-57834921 CAGATTCAATAAATGGTGCTGGG + Intergenic
1127989990 15:64106940-64106962 CAGCAGCAATAAAAACTAATAGG + Intronic
1128817733 15:70626385-70626407 CAGCAACAATGGATGGAACTGGG + Intergenic
1130790925 15:87155566-87155588 CAGTAGCACTAAATGCAACTTGG - Intergenic
1136280241 16:29204105-29204127 CAGCAGCCACAAGTGGGACTCGG - Intergenic
1138237827 16:55400081-55400103 CAGCAGCTATAAACTGTACCAGG + Intronic
1140487825 16:75308007-75308029 CAGCTGCACTAGATGGTTCTGGG + Intronic
1141211401 16:81983808-81983830 AAGATGCAATAAATGGTGCTAGG + Intergenic
1141680846 16:85542846-85542868 CTGCTGCAATACAGGGTACTCGG + Intergenic
1142914588 17:3125887-3125909 CAGCACCTATCAATGGTACCAGG + Intergenic
1147032514 17:37651172-37651194 AAGCAGCAATTAATGAAACTTGG + Intergenic
1147881603 17:43657868-43657890 TAGCAGCTGTAAATGGTATTAGG - Intronic
1148875097 17:50682531-50682553 CAGCAGGCATAAATGGCTCTAGG - Intronic
1149131138 17:53303615-53303637 CAGATTCAATAAATGGTGCTGGG + Intergenic
1149463446 17:56853532-56853554 TCTCATCAATAAATGGTACTGGG - Intronic
1149920402 17:60653291-60653313 GAGCAACAATAAATGGTAGGGGG - Intronic
1152185913 17:78856175-78856197 CAGCAACAATAAAAGGGCCTGGG + Intronic
1152289158 17:79429053-79429075 CAGCAGCAGGAAAAGGTTCTGGG - Intronic
1153862636 18:9229042-9229064 CATCTTCAATAAATGGTGCTGGG - Intronic
1157014647 18:43697495-43697517 CAGCAGCAAAAAATAGTAGCTGG + Intergenic
1158002369 18:52634223-52634245 CAGCAGTAATAAATTTTAATCGG + Intronic
1161348923 19:3781846-3781868 CAACAACAATAATTGGTACCAGG - Intronic
1162433015 19:10640666-10640688 ATGCAGCAGTAAATGGGACTGGG + Intronic
1163086778 19:14986927-14986949 CAGCAGCACCAAACTGTACTAGG - Intronic
1163999992 19:21089658-21089680 CAGCAGCCTTAAAGGGTCCTAGG + Intronic
1164523330 19:28995474-28995496 CACCAGCAATGAAAGTTACTTGG - Intergenic
1164567064 19:29333581-29333603 CAGCAACAATAAATCGTCTTTGG + Intergenic
1167827165 19:51984197-51984219 AAAAATCAATAAATGGTACTGGG + Intronic
925303048 2:2830508-2830530 CTGCAGCCAGAAATGGTGCTGGG - Intergenic
925715473 2:6780815-6780837 CAGCAGGAGGAACTGGTACTTGG - Intergenic
928639670 2:33284989-33285011 ATGCAGTAATAACTGGTACTTGG + Intronic
929522044 2:42662479-42662501 CAAATTCAATAAATGGTACTGGG - Intronic
930543361 2:52735585-52735607 CAGCAGCGAGAAAAGGAACTTGG - Intergenic
930618025 2:53614327-53614349 CTTCTTCAATAAATGGTACTGGG - Intronic
930651420 2:53968665-53968687 AACCAGCAAGAAATGCTACTGGG - Intronic
931087097 2:58844642-58844664 CAGCAAGAGTAAATGGCACTGGG + Intergenic
933233386 2:79835998-79836020 CAGCAACTAGAAATGGTGCTAGG - Intronic
933504975 2:83165227-83165249 CAGCTGCACTGAATGTTACTTGG - Intergenic
935534652 2:104279942-104279964 AAGCAACATTAAAAGGTACTGGG - Intergenic
939332130 2:140777962-140777984 CAGTAGCATTAAACTGTACTAGG + Intronic
939639571 2:144623016-144623038 CATAATCAATAAATGGTGCTGGG - Intergenic
941452660 2:165678320-165678342 CAGCAGAAAGAAAAGGAACTTGG + Intronic
943403615 2:187450673-187450695 CAGAAAAAATAAATGGTACAAGG + Intergenic
944097983 2:195991766-195991788 TAGCAGCAACCAATGGTACCAGG + Intronic
945049979 2:205814436-205814458 CAGCAACAATAGATGGCACAAGG + Intergenic
945473148 2:210250385-210250407 CATCATCAATAAATGGAACTGGG - Intergenic
945531213 2:210955532-210955554 CAGCAAGAATAAATGGAAGTTGG - Intergenic
946990725 2:225326577-225326599 CAGGAAGAATAAATGGAACTGGG + Intergenic
1169089075 20:2846906-2846928 CAGCAGCAGTAAATGGACCTTGG - Intronic
1172500781 20:35425515-35425537 CAGTAGTAAAAACTGGTACTAGG - Intergenic
1173022756 20:39281977-39281999 CAGCAGCTAAGAGTGGTACTTGG + Intergenic
1177467831 21:21512324-21512346 TCTCATCAATAAATGGTACTGGG - Intronic
1177506204 21:22020831-22020853 CAGTAGAAATAAAAGGCACTTGG - Intergenic
950608084 3:14102291-14102313 CATATTCAATAAATGGTACTGGG + Intergenic
950980077 3:17293924-17293946 CAGATGCAATAATTGATACTTGG + Intronic
951102646 3:18707197-18707219 TATCTTCAATAAATGGTACTGGG + Intergenic
951382715 3:22004206-22004228 CGTCTTCAATAAATGGTACTGGG + Intronic
951640446 3:24829658-24829680 CAATAGCAATAAAGGGAACTTGG - Intergenic
952014149 3:28937296-28937318 CAAAAACAATAAATGGTGCTGGG + Intergenic
952234574 3:31465675-31465697 AAGCATCAATAAATCCTACTGGG - Intergenic
954326694 3:49867944-49867966 CAGGAGCTATCCATGGTACTGGG + Intronic
954522775 3:51243931-51243953 CAGCTTCAATAAATGGAACTGGG - Intronic
956618587 3:71198194-71198216 CAGCAGCAGCAACAGGTACTGGG - Intronic
956967271 3:74476417-74476439 CAGCAGCAATAACAGCTGCTAGG + Intronic
959767912 3:110055294-110055316 CACAATCAATAAATGGTGCTAGG + Intergenic
960040402 3:113144521-113144543 CAGTGGAAATAAATGGTAGTGGG + Intergenic
960784728 3:121359679-121359701 CATCTTCAATAAATGGCACTGGG - Intronic
961190352 3:124955586-124955608 CATATGCAATAAATGGTGCTAGG - Intergenic
961221409 3:125203497-125203519 CCTCTTCAATAAATGGTACTAGG + Intronic
961885422 3:130093775-130093797 CAGCAGCAGTAACTGGGACAGGG - Intronic
963853416 3:150229539-150229561 CTGCTTCAATAAATGGTGCTGGG + Intergenic
966591017 3:181683030-181683052 AGTCTGCAATAAATGGTACTGGG - Intergenic
972143585 4:35992953-35992975 CTGCAAAAATAAATGGTAGTTGG - Intronic
972894361 4:43600900-43600922 CAGTAGCAATAATTGGTATGTGG + Intergenic
973022711 4:45223702-45223724 CAGATTCAATAAATGGTGCTGGG - Intergenic
973954311 4:56048636-56048658 CAACCACAATAAATGGCACTGGG - Intergenic
974871453 4:67648566-67648588 CAGCAGAAATAATTGGCACAAGG - Intronic
975239918 4:72045120-72045142 CCTCTTCAATAAATGGTACTGGG - Intronic
976116145 4:81729413-81729435 CCTCATCAATAAATGGTGCTGGG + Intronic
979338173 4:119487965-119487987 CAACATCAATGAATGGTATTAGG - Intergenic
980587522 4:134836076-134836098 CCTCATCAATAAATGGAACTGGG - Intergenic
982668954 4:158297462-158297484 CAGGTGCCATAAATTGTACTGGG - Intergenic
983457100 4:167978914-167978936 TATCTTCAATAAATGGTACTGGG + Intergenic
983710155 4:170705054-170705076 CAGCTTCAATAAATTGTGCTGGG + Intergenic
983932324 4:173465999-173466021 TACCAGCAATAAAGGATACTTGG + Intergenic
984121167 4:175746511-175746533 CTGCAGCAAAAAATGGCATTTGG + Intronic
984219682 4:176957509-176957531 CAGCAGTAACAATTGGTATTTGG - Intergenic
987878841 5:23714763-23714785 CTCCAGCAATAAATGGTTCTGGG + Intergenic
989175434 5:38520664-38520686 CATCTTCAATAAATGGTACTGGG - Intronic
989239011 5:39182148-39182170 AAGCAATAAAAAATGGTACTGGG - Intronic
990223612 5:53624100-53624122 AAGCACCAACAAATGGTGCTGGG - Intronic
990908443 5:60828230-60828252 GAGCAGCAAAAAAGTGTACTTGG - Intronic
991179058 5:63727610-63727632 CAGAAGCAGGAAATTGTACTGGG - Intergenic
992589846 5:78283220-78283242 CAGAGTTAATAAATGGTACTTGG - Intronic
993170806 5:84416721-84416743 CCACTTCAATAAATGGTACTAGG - Intergenic
995278181 5:110302004-110302026 CCTCCTCAATAAATGGTACTGGG - Intronic
996123320 5:119695622-119695644 CATTTTCAATAAATGGTACTGGG - Intergenic
997111847 5:131083556-131083578 CAGCTGCATTTAATGGTACCAGG + Intergenic
997904013 5:137796404-137796426 GAGCAGAAATCAATGGTACAAGG + Intergenic
998363989 5:141617070-141617092 CAGCAGCAATAGCTGGAATTTGG + Intronic
998946363 5:147344195-147344217 AATGAGCAATAGATGGTACTTGG - Intronic
999110268 5:149114207-149114229 CAGCACAAGTAAATGGTATTGGG + Intergenic
1000462312 5:161537893-161537915 CAGGATAAATAAATGGTATTAGG - Intronic
1002809403 6:612728-612750 CAGCAGCAATAAAAGGAACAGGG + Intronic
1004828737 6:19453428-19453450 CTTCAGCAAAAAAAGGTACTTGG + Intergenic
1004880634 6:20003904-20003926 CAGCAGTAACAGATGGTTCTCGG - Intergenic
1005603925 6:27456277-27456299 CAGAAGCTATACATGTTACTAGG + Intronic
1007495066 6:42254352-42254374 CATGAGTAATAAATGCTACTAGG + Intronic
1008264274 6:49404922-49404944 CCTCTTCAATAAATGGTACTGGG - Intergenic
1008820030 6:55620855-55620877 CTTCATCAATAAATGGTGCTGGG - Intergenic
1011153583 6:84303072-84303094 TCGCTGCAATAAATGGTATTGGG + Intergenic
1011159742 6:84375745-84375767 CATCTTCAATAAATGGTGCTGGG - Intergenic
1012720808 6:102741439-102741461 CAGAAAAAATAAATGGGACTTGG + Intergenic
1016320868 6:142844469-142844491 AAGCATTAAGAAATGGTACTTGG + Intronic
1016725390 6:147359317-147359339 CAGCAGCAATACATACCACTTGG - Exonic
1018262758 6:161986698-161986720 CAGCAGCAGTAAATGTTAGGAGG - Intronic
1020685499 7:11288854-11288876 CAGCAGCAGTAGATGGTGGTGGG - Intergenic
1020812984 7:12868576-12868598 TAGTAGCAATAAATGGCACATGG - Intergenic
1022945038 7:35274769-35274791 CTTCTACAATAAATGGTACTGGG + Intergenic
1023113966 7:36842159-36842181 AACCAGCAAAAAATGGTACCAGG - Intergenic
1026071965 7:67129923-67129945 GTTCATCAATAAATGGTACTTGG - Intronic
1026704943 7:72682331-72682353 GTTCATCAATAAATGGTACTTGG + Intronic
1027364836 7:77446690-77446712 CCACAGGAAGAAATGGTACTAGG - Intergenic
1028965609 7:96797996-96798018 TAGCAGCAGTAAGTGGTAGTAGG - Intergenic
1029670716 7:102028748-102028770 CAGCAGCCATAGAGGGGACTGGG + Intronic
1029862430 7:103587288-103587310 CCTCTGCAATAAATGGTGCTGGG + Intronic
1033843383 7:145402694-145402716 CAGGAGAAATAAAGGGAACTGGG - Intergenic
1035142163 7:156773608-156773630 CCTCTTCAATAAATGGTACTGGG + Intronic
1036911312 8:12759521-12759543 AATGAGCAGTAAATGGTACTTGG - Intergenic
1036954034 8:13167936-13167958 AAGTATTAATAAATGGTACTTGG - Intronic
1038357398 8:26842075-26842097 CAGCAGAAATAATTGGCATTTGG - Intronic
1041350697 8:56945440-56945462 CAGCAACCATAAATGCTATTTGG - Intergenic
1041425319 8:57714156-57714178 CCCCATCAATAAATGGTGCTGGG + Intergenic
1044361963 8:91296135-91296157 CATCAGTAACAAATGGTGCTTGG + Intronic
1044495588 8:92876543-92876565 CAACTCAAATAAATGGTACTGGG + Intergenic
1044809925 8:96049396-96049418 CACCTTCAATAAATGGTGCTGGG + Intergenic
1047345621 8:124025411-124025433 CCTTATCAATAAATGGTACTGGG - Intronic
1047467837 8:125135642-125135664 CTTCAGCAACAAATGGTGCTAGG - Intronic
1047814529 8:128448281-128448303 AAGCTGTAATAAATGGGACTGGG + Intergenic
1048912117 8:139145447-139145469 AATCATCAATAAATGGTATTGGG - Intergenic
1049127153 8:140801651-140801673 CAGCAGCAGTACCTGATACTGGG - Intronic
1050966761 9:11814009-11814031 TACCTTCAATAAATGGTACTGGG - Intergenic
1051477386 9:17522885-17522907 AAGCAGAATTTAATGGTACTTGG - Intergenic
1055861132 9:80750619-80750641 CTGAAGCAATAAAAGGTGCTGGG - Intergenic
1056905654 9:90645498-90645520 CACCAGCAGCAAATGGTAGTGGG + Intergenic
1057434057 9:95023148-95023170 CAGTAGTAATTAATGTTACTGGG + Intronic
1187205808 X:17180110-17180132 CATCAGCAATATATGGGAGTGGG + Intergenic
1187649213 X:21381893-21381915 CAGGAGATATACATGGTACTAGG - Intronic
1187854535 X:23624078-23624100 CAGCAGAAAAAAATGTTAATTGG - Intergenic
1192116291 X:68414792-68414814 CATCAGCAAGTAATGGTAATGGG - Intronic
1192381865 X:70625638-70625660 CAGCAACAATGAAGGGTAGTGGG - Intronic
1192716356 X:73647031-73647053 CCTCTTCAATAAATGGTACTGGG - Intronic
1193262840 X:79429341-79429363 TCTCTGCAATAAATGGTACTGGG - Intergenic
1193425129 X:81332972-81332994 TAGCCACAATAAATGGTGCTGGG - Intergenic
1193832273 X:86304130-86304152 CTGCTTCAATAAATGGTGCTAGG + Intronic
1197448573 X:126581441-126581463 CAGCAGCAATAAATGAAAGATGG + Intergenic
1198928492 X:141825718-141825740 CGACAGCAAAAAATGGTGCTGGG - Intergenic
1199218704 X:145291697-145291719 CAGAAAAAATAATTGGTACTAGG + Intergenic
1199681371 X:150226740-150226762 CAGCATCTGTAAATGGTACAAGG - Intergenic
1199750177 X:150808416-150808438 CAGTGGCACCAAATGGTACTAGG + Intronic
1200313810 X:155109072-155109094 AGGCAGCAATAAATGGTGCCAGG - Intronic
1200368111 X:155689340-155689362 CAACAACAATAAATGGTGCTGGG - Intergenic