ID: 913281987

View in Genome Browser
Species Human (GRCh38)
Location 1:117194714-117194736
Sequence GTGGTAACACAGATGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913281982_913281987 6 Left 913281982 1:117194685-117194707 CCTATGAGAGGCAGGAAATCCTG 0: 1
1: 0
2: 3
3: 14
4: 210
Right 913281987 1:117194714-117194736 GTGGTAACACAGATGGAACCTGG 0: 1
1: 0
2: 1
3: 8
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913281987 Original CRISPR GTGGTAACACAGATGGAACC TGG Intronic
900467046 1:2830934-2830956 GTGGGAGCACAGGTGGGACCTGG - Intergenic
900483227 1:2909453-2909475 GTGGTCACACAGCTTGAACTTGG + Intergenic
903018477 1:20377236-20377258 GAGGTCACACAGCTGGGACCTGG - Intergenic
903537463 1:24076474-24076496 GAAATAAAACAGATGGAACCTGG - Intronic
905343020 1:37292232-37292254 GTGGAAACACAACTGAAACCTGG - Intergenic
908152884 1:61322434-61322456 GCAGTAAGACAGAAGGAACCTGG - Intronic
910104730 1:83619352-83619374 GTGGTAACAGAGTAGGGACCTGG + Intergenic
910568060 1:88667548-88667570 GTGGAAAGACAGAAAGAACCTGG - Intergenic
910586923 1:88890972-88890994 TTGGTAAGCCAGATGGAACCTGG - Intronic
911607067 1:99919162-99919184 GGGGGAACACAGGTGGAGCCTGG - Intronic
913281987 1:117194714-117194736 GTGGTAACACAGATGGAACCTGG + Intronic
915218038 1:154352932-154352954 CTGGGAGCACAGATGGAAGCGGG - Intergenic
915230057 1:154438819-154438841 GTGCCAACAAAGATGGAAGCCGG - Intronic
915532171 1:156508998-156509020 GTGGACACAGAGATGGCACCAGG + Intergenic
917218380 1:172701705-172701727 GTGGGAACACAGAGGGAAAATGG + Intergenic
917986901 1:180329802-180329824 GTGGTGACACTGATGGCAACTGG - Intronic
920934847 1:210422548-210422570 GAGGCAACAAAGATGGAACTGGG - Intronic
921784335 1:219210338-219210360 GTGGTGACATAGAGGGAACAGGG + Intronic
1063460015 10:6209287-6209309 GGGGGAACACAGATGTCACCGGG - Intronic
1065378209 10:25063702-25063724 GTGGGAACAAAGATGGACACGGG - Intergenic
1065519281 10:26555690-26555712 GTGGGAGGATAGATGGAACCAGG - Intronic
1073664434 10:105514330-105514352 CTGGTAAAACAGATGCAACGTGG + Intergenic
1074860808 10:117508939-117508961 GTGGTAGCACCTATGGAATCAGG - Intergenic
1076120493 10:127933077-127933099 GTGGTAACACAGGGTGCACCCGG + Intronic
1076515132 10:131041188-131041210 GATGAAACACAGATGGACCCTGG - Intergenic
1077293259 11:1810384-1810406 GTGGGAAGACAGTTTGAACCTGG + Intergenic
1083777434 11:64901052-64901074 GTGGTGACACAGCTGCATCCCGG - Exonic
1083986493 11:66219211-66219233 GTGGTGTCACAGATGGAAAAGGG + Intronic
1084883542 11:72188998-72189020 GTGGTACCACAGATGGGAAAAGG - Intergenic
1086222881 11:84471128-84471150 CTGGCAACCCAGATGGAACTGGG + Intronic
1086601865 11:88642962-88642984 GTGGAAGCACATTTGGAACCAGG - Intronic
1086767249 11:90711961-90711983 GTAGTAACATGGATGGAACTGGG - Intergenic
1086835549 11:91617117-91617139 GTGACAACACGGATGGAACTGGG - Intergenic
1088114233 11:106297801-106297823 ATGGTAACATAGATCTAACCAGG - Intergenic
1089677598 11:120100160-120100182 GTGGGAAGATGGATGGAACCTGG - Intergenic
1092431698 12:8414944-8414966 GTGGTGACACAGCTGAAGCCAGG + Intergenic
1092434649 12:8437567-8437589 GTGGTGACACAGCTGAAGCCAGG + Intergenic
1097132588 12:56823565-56823587 GTGGAAAAGCAGATGGAACTTGG - Intergenic
1097401051 12:59128349-59128371 ATGGTTTCATAGATGGAACCAGG + Intergenic
1098084873 12:66831638-66831660 GTGGTCACACAGCTGGAAAATGG + Intergenic
1098713843 12:73802983-73803005 GTAACAACACAGATGGAACTTGG - Intergenic
1099317081 12:81097521-81097543 GTGATAACAAAGATGGAAGCAGG - Intronic
1099430280 12:82575162-82575184 GTGGGAACAGAGAAGGGACCTGG - Intergenic
1100193195 12:92215105-92215127 GTGGTAACACGAATGGACCTGGG - Intergenic
1101172652 12:102114915-102114937 GTGGTTCCAGAGATGGAACGTGG - Intronic
1102672048 12:114628466-114628488 GTGGTTGCAGAGATGGAAGCAGG - Intergenic
1106220352 13:27741713-27741735 TTGGTAACACAGAGAGAAGCAGG - Intergenic
1107064306 13:36195996-36196018 GTGGTGACACAGAGGGAATAGGG + Intronic
1108038659 13:46319052-46319074 GTGGCAACATAGGTGGAACTGGG + Intergenic
1108187876 13:47906640-47906662 GTGGTTTCAGAGATGTAACCAGG - Intergenic
1109074174 13:57812160-57812182 GTGGTAACATGGATGGACCTGGG + Intergenic
1109384090 13:61604642-61604664 GTGGGAACACAGATAGAAGATGG + Intergenic
1112615276 13:100998066-100998088 GTGGTAACATGGGTGGAAACAGG - Intergenic
1115453693 14:33577540-33577562 ATGGAAACACAGAGAGAACCAGG + Intronic
1120775491 14:88431752-88431774 GTGGCAACATGGATGGAACATGG - Intronic
1126219914 15:46200954-46200976 GTGGGAACACAGATTGATGCGGG - Intergenic
1127327834 15:57912709-57912731 TTGGAAACACAGACAGAACCTGG - Intergenic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128386210 15:67150427-67150449 GGGGTAAAACAAGTGGAACCAGG - Intronic
1128535707 15:68488688-68488710 GTCTTAACACAGATGGCAGCAGG + Intergenic
1132176790 15:99722143-99722165 GTGGGAACACAGATGATTCCTGG - Intronic
1134372659 16:13639611-13639633 GTGGGAAAACAGCTTGAACCCGG - Intergenic
1136565053 16:31064780-31064802 ATGGTGAGACAGATGGAACCTGG - Exonic
1137833593 16:51568800-51568822 GTGCTAACATAGAAGGAACCAGG - Intergenic
1139261176 16:65595713-65595735 GTGGCACCTCAGATGGGACCAGG - Intergenic
1139611114 16:68059462-68059484 GTGGAAGGACAGATGGAGCCAGG + Intronic
1141285341 16:82666763-82666785 AAGGTCACACAGATGGAAGCTGG + Intronic
1141854607 16:86672597-86672619 CTGCTCACACAGCTGGAACCCGG - Intergenic
1143718407 17:8792834-8792856 CTGGAAAGACAGATGGGACCAGG - Intergenic
1144160867 17:12556537-12556559 GTGGTAAGACATATGGTAGCTGG - Intergenic
1146217350 17:30988200-30988222 GTGGTAATACAGCTGGACTCTGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1148695374 17:49555402-49555424 CTGGGCACACAGGTGGAACCAGG - Intergenic
1149159125 17:53668763-53668785 CTGCTAACAAAGATGGACCCAGG - Intergenic
1150068010 17:62127745-62127767 TTTGTAAGACAGAAGGAACCCGG + Intergenic
1151600653 17:75104203-75104225 CTGGTCACACAGATGAACCCTGG - Intronic
1158511981 18:58098528-58098550 GTGGTCACACAGCTGGAAGATGG - Intronic
1160238952 18:77108920-77108942 GGGGTCACCCAGATGGAACCTGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1168389163 19:55992163-55992185 GTGGGAACATGGATGGAACTGGG - Intergenic
926621557 2:15050749-15050771 GTGGAAACCCAGATGGAACCCGG - Intergenic
930411301 2:51028680-51028702 CTGGTACCACTGGTGGAACCTGG - Exonic
930429601 2:51257390-51257412 GTAGTAACATGGATGGAACTAGG + Intergenic
930944983 2:57062441-57062463 TTGGTCACACAGATCCAACCTGG - Intergenic
931289861 2:60862862-60862884 GTGGTAACATAGAATGAAACAGG - Intergenic
931349897 2:61477606-61477628 ATGAGAACACAGATGTAACCTGG - Intergenic
934980246 2:98833544-98833566 TTGGTCACACAGATGGTGCCAGG - Intronic
935824723 2:106934102-106934124 GTGGAAATACAGATGGACCTTGG - Intergenic
935902833 2:107810980-107811002 CTAGTAACACAGAGGAAACCAGG + Intergenic
939114070 2:138040552-138040574 GAGGGAACACAAAGGGAACCTGG + Intergenic
939122443 2:138133956-138133978 GTGGTGATACAGATGGGCCCTGG - Intergenic
944214334 2:197239023-197239045 GCAGCAAGACAGATGGAACCTGG - Intronic
946798895 2:223388586-223388608 GTGGTAAGACATATGGATACTGG + Intergenic
1171416749 20:24986691-24986713 GTGGGCAACCAGATGGAACCAGG + Intronic
1174113312 20:48210915-48210937 GTGGCCGCACAGATGGAAACGGG - Intergenic
1174175293 20:48640791-48640813 GTGGGCACACAGATGGAAGGAGG + Intronic
1174565107 20:51458854-51458876 ATGGTACCACAGATAAAACCTGG - Intronic
1175446406 20:59023198-59023220 GTGGTTTCACAAATGAAACCAGG + Intronic
1181764180 22:25079471-25079493 GGGGAAAGACAGAAGGAACCAGG + Intronic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1182394822 22:30027453-30027475 GTGGCAACACAGTTTGAACGTGG + Exonic
1184806337 22:46796963-46796985 GTGGGGACACAGCAGGAACCAGG - Intronic
952300333 3:32099241-32099263 GTGGTAACAGTGATGGAGACAGG - Intergenic
953036797 3:39219007-39219029 GAGGAAACACTGCTGGAACCAGG - Intergenic
954140537 3:48602873-48602895 GTGGTTTTATAGATGGAACCTGG - Intronic
955809087 3:62767608-62767630 TTTGTGACACAGATGGAAGCTGG + Intronic
958595454 3:96216526-96216548 CTGGTTACATAGATAGAACCAGG - Intergenic
961639565 3:128356719-128356741 GTGGATACACAGAAGGAATCAGG - Intronic
963346958 3:144106327-144106349 GTGGTTTCACAGATGAAATCTGG + Intergenic
964714236 3:159705307-159705329 GTGGTCACATAGAAGGAAGCTGG - Intronic
966264098 3:178016901-178016923 GTTGAGACACAAATGGAACCTGG + Intergenic
972663369 4:41140485-41140507 GTGGGAACAGAGATGGAATTAGG - Intronic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
983446073 4:167854499-167854521 GTGGTACCATAGAGGAAACCTGG - Intergenic
983899902 4:173122673-173122695 GTGTGAACTCAGGTGGAACCAGG + Intergenic
984731495 4:183072441-183072463 GGGTAAACACAGATTGAACCAGG - Intergenic
986825040 5:11511397-11511419 GTGGTAACAAAGAGGAAGCCAGG + Intronic
990637871 5:57749890-57749912 GTTGTAAGACAGATGAAACAAGG - Intergenic
996177869 5:120381192-120381214 GTGGTTACTCTGATGGATCCTGG - Intergenic
997421040 5:133766963-133766985 GTGCGAAGACAGGTGGAACCAGG + Intergenic
1000969791 5:167701087-167701109 GTGGTCACACAGATGAAATGTGG - Intronic
1003494334 6:6651015-6651037 GTGGCAACATGGATGGAACTGGG - Intronic
1003711323 6:8594023-8594045 GCAGCAACACAGATGGAACTGGG + Intergenic
1006486911 6:34350308-34350330 CTGGTACCCCAGATGGCACCAGG + Intronic
1007136619 6:39528256-39528278 GTGACAACATAGATGGAACTGGG - Intronic
1007717320 6:43864832-43864854 ATGGTAACTCAGGTGGAACTGGG + Intergenic
1009512241 6:64567985-64568007 GTGGGAACACAAATGGAACATGG + Intronic
1010902513 6:81444159-81444181 GAGGTAACAAAGATGAGACCTGG - Intergenic
1012096571 6:94970087-94970109 GTGGGGACATAGATGGAGCCGGG + Intergenic
1013362962 6:109411519-109411541 CTGGTTACACAGATATAACCAGG + Intronic
1014594358 6:123314690-123314712 GCAGTGACACAGATGGAACAAGG + Intronic
1019571212 7:1713311-1713333 GTGGCAAGACAGATGGGCCCTGG + Intronic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1022564546 7:31384867-31384889 GGGGTAACACAGATGAGACAGGG - Intergenic
1023935703 7:44738299-44738321 GTGTTTATACAGATGGAACTGGG - Intergenic
1024970052 7:55060832-55060854 ATGGTTACACAGTTGGAAACAGG - Intronic
1026229137 7:68468080-68468102 GAGGTGGCAGAGATGGAACCAGG + Intergenic
1029504186 7:100952200-100952222 GTGGTCACACAGATGGAGGTGGG - Exonic
1031105493 7:117536991-117537013 TTGGTAACTCACATGGAACTGGG + Intronic
1033611692 7:142969295-142969317 GTGGAAGCAGAGATGAAACCAGG - Intergenic
1035053260 7:156016678-156016700 GTGGGAAAACACATGGAATCGGG + Intergenic
1036819485 8:11928732-11928754 GTGGTGACACAGCTGAAATCAGG + Intergenic
1036832655 8:12033781-12033803 GTGGTGACACAGCTGAAGCCAGG + Intergenic
1037521562 8:19684937-19684959 GTGGGAACAGGGATGGATCCAGG - Intronic
1042099685 8:65261636-65261658 GTGGTAAAAAAGATAGAACTTGG - Intergenic
1044692081 8:94891085-94891107 GAAGTAACACAGTGGGAACCTGG + Intronic
1045152207 8:99421497-99421519 GTGGTTACAAGGATGGACCCTGG + Intronic
1047029351 8:120860266-120860288 ATGGAAACACAGAAGAAACCTGG - Intergenic
1049342328 8:142119809-142119831 GGGGTCACAGAGATGGAAGCAGG - Intergenic
1049360111 8:142208465-142208487 ATGGTAACACAGCTGTATCCAGG - Intergenic
1053332074 9:37221080-37221102 GTGGCTACACTGGTGGAACCTGG - Intronic
1055164260 9:73172291-73172313 GTGGGAAATCAGAGGGAACCTGG + Intergenic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1060197357 9:121632349-121632371 GTGATAAAACAGATGGGTCCTGG + Intronic
1062312170 9:135944756-135944778 GTGGCAACACAGAGGAAACTGGG + Intronic
1185561950 X:1066744-1066766 GTGGTAACTGAGATGAAACGGGG + Intergenic
1187489715 X:19739612-19739634 GGGGTATCACAGATAGAACAAGG + Intronic
1193033397 X:76923782-76923804 GGGGAAACACAGGTGAAACCTGG + Intergenic
1193453308 X:81698361-81698383 TTGGTAACACAGGTGAAAACAGG - Intergenic
1198057007 X:133005467-133005489 GTGGTGGCAGAGATGGAAGCTGG + Intergenic
1198237378 X:134747994-134748016 GTGATAGCACAGAGAGAACCTGG - Intronic
1198244815 X:134820041-134820063 GTGGAAAGATAGAAGGAACCTGG - Intronic
1199370678 X:147043808-147043830 GCTGTGACACAGATGGACCCAGG - Intergenic
1199559305 X:149146273-149146295 GTGGTAACAGACATGCAAACAGG + Intergenic
1199812624 X:151365752-151365774 GTGGTAACCAAGATGAAACCTGG - Intergenic
1201324800 Y:12744658-12744680 ATGGTAATGCAAATGGAACCAGG - Intronic