ID: 913282217

View in Genome Browser
Species Human (GRCh38)
Location 1:117197312-117197334
Sequence GAGAGCAATGAGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913282217_913282224 2 Left 913282217 1:117197312-117197334 CCCTCCCCCTTCTCATTGCTCTC No data
Right 913282224 1:117197337-117197359 AGAACTCAGGATATATTATTAGG 0: 1
1: 0
2: 2
3: 17
4: 244
913282217_913282225 24 Left 913282217 1:117197312-117197334 CCCTCCCCCTTCTCATTGCTCTC No data
Right 913282225 1:117197359-117197381 GATATTTTTGACTTTTACAGAGG 0: 1
1: 0
2: 0
3: 28
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913282217 Original CRISPR GAGAGCAATGAGAAGGGGGA GGG (reversed) Intronic
No off target data available for this crispr