ID: 913282224

View in Genome Browser
Species Human (GRCh38)
Location 1:117197337-117197359
Sequence AGAACTCAGGATATATTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 244}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913282219_913282224 -2 Left 913282219 1:117197316-117197338 CCCCCTTCTCATTGCTCTCAGAG No data
Right 913282224 1:117197337-117197359 AGAACTCAGGATATATTATTAGG 0: 1
1: 0
2: 2
3: 17
4: 244
913282215_913282224 29 Left 913282215 1:117197285-117197307 CCTAAAGAGAAGTAGCAATGTTC 0: 1
1: 0
2: 2
3: 22
4: 175
Right 913282224 1:117197337-117197359 AGAACTCAGGATATATTATTAGG 0: 1
1: 0
2: 2
3: 17
4: 244
913282216_913282224 3 Left 913282216 1:117197311-117197333 CCCCTCCCCCTTCTCATTGCTCT 0: 1
1: 1
2: 4
3: 89
4: 1034
Right 913282224 1:117197337-117197359 AGAACTCAGGATATATTATTAGG 0: 1
1: 0
2: 2
3: 17
4: 244
913282220_913282224 -3 Left 913282220 1:117197317-117197339 CCCCTTCTCATTGCTCTCAGAGA 0: 1
1: 0
2: 1
3: 28
4: 287
Right 913282224 1:117197337-117197359 AGAACTCAGGATATATTATTAGG 0: 1
1: 0
2: 2
3: 17
4: 244
913282221_913282224 -4 Left 913282221 1:117197318-117197340 CCCTTCTCATTGCTCTCAGAGAA 0: 1
1: 0
2: 1
3: 36
4: 341
Right 913282224 1:117197337-117197359 AGAACTCAGGATATATTATTAGG 0: 1
1: 0
2: 2
3: 17
4: 244
913282217_913282224 2 Left 913282217 1:117197312-117197334 CCCTCCCCCTTCTCATTGCTCTC No data
Right 913282224 1:117197337-117197359 AGAACTCAGGATATATTATTAGG 0: 1
1: 0
2: 2
3: 17
4: 244
913282222_913282224 -5 Left 913282222 1:117197319-117197341 CCTTCTCATTGCTCTCAGAGAAC No data
Right 913282224 1:117197337-117197359 AGAACTCAGGATATATTATTAGG 0: 1
1: 0
2: 2
3: 17
4: 244
913282218_913282224 1 Left 913282218 1:117197313-117197335 CCTCCCCCTTCTCATTGCTCTCA No data
Right 913282224 1:117197337-117197359 AGAACTCAGGATATATTATTAGG 0: 1
1: 0
2: 2
3: 17
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913282224 Original CRISPR AGAACTCAGGATATATTATT AGG Intronic
900673739 1:3871221-3871243 GGAACTCAGAACATATTGTTAGG + Intronic
900862116 1:5241235-5241257 AGACCTCAGTATACACTATTAGG - Intergenic
903758197 1:25678200-25678222 AATGCTCAGTATATATTATTAGG - Intronic
906598169 1:47098620-47098642 AAAGCTCATGATTTATTATTAGG - Intronic
907080822 1:51620158-51620180 AGAACTAAGGATATAAATTTAGG + Intronic
908358310 1:63343754-63343776 AGAACTATGGATAAATTTTTAGG - Intergenic
908940964 1:69433245-69433267 AGAACTCAGCATCTTTTGTTTGG - Intergenic
909878761 1:80846411-80846433 CGAACTCATTATATATTCTTGGG + Intergenic
910091520 1:83470081-83470103 ATAACTGAGGTTATATTCTTAGG - Intergenic
910482233 1:87671151-87671173 AGTTTTCAGGCTATATTATTAGG + Intergenic
912052484 1:105547047-105547069 AAAAGTCAGGATACATAATTAGG + Intergenic
912143680 1:106763940-106763962 AGAAAACAGGATGTCTTATTCGG + Intergenic
913282224 1:117197337-117197359 AGAACTCAGGATATATTATTAGG + Intronic
915847514 1:159283059-159283081 AGTAGTCAGGATATAATATATGG - Intergenic
917910984 1:179645742-179645764 ACAATTGAGGCTATATTATTAGG + Intronic
919546438 1:198926201-198926223 AGAGCTCAGAATTTATTAATTGG + Intergenic
919765282 1:201123295-201123317 GGAGCTCAGGAGATGTTATTTGG - Intronic
920627012 1:207612488-207612510 TGACCTGAAGATATATTATTGGG - Intronic
922064717 1:222125570-222125592 AGAACTCTGGATATATAAGAAGG + Intergenic
922519201 1:226232885-226232907 AGAAATCAGGACATATATTTAGG - Intronic
922570321 1:226630912-226630934 AGAACTCAGAATTCTTTATTTGG - Intergenic
924760276 1:246978108-246978130 AGAACACAGGAGACATGATTGGG + Intronic
1064697134 10:17978823-17978845 AGGACTCTGCCTATATTATTAGG + Intronic
1065410284 10:25419312-25419334 AGAAATCAGGTTATAATATATGG - Intronic
1065527593 10:26638532-26638554 AGAACTCAAGATATGAAATTGGG - Intergenic
1065559243 10:26945853-26945875 AGAACTCAAGATATGAAATTGGG + Intergenic
1065689782 10:28321186-28321208 AGAAATTAGGATATATATTTGGG + Intronic
1066080304 10:31924700-31924722 AGAATTCAGAATATGTTATGAGG - Intronic
1071063672 10:81605039-81605061 AGAACTTAGGCTTTCTTATTTGG + Intergenic
1071353081 10:84766210-84766232 AGAACTCAGCATAAACTCTTGGG + Intergenic
1071614136 10:87058945-87058967 AAAACTCTGGATATAATATATGG + Intronic
1072135432 10:92541140-92541162 AGAAGTCATGATATTTGATTAGG - Intronic
1073547621 10:104364997-104365019 AGAACTGAGGATGTTTCATTTGG - Intronic
1073926051 10:108518170-108518192 AGACCACAGCATATATAATTTGG - Intergenic
1076181701 10:128414465-128414487 AGGTCTCAGGAAATATTTTTTGG - Intergenic
1078041896 11:7873079-7873101 AGAACACAGAATACATTATCTGG + Intergenic
1081005325 11:37729248-37729270 AGACCTCAGGATATAGTAACAGG - Intergenic
1081474747 11:43416607-43416629 AGAATTCAGAGAATATTATTGGG + Intronic
1082806661 11:57456035-57456057 AGAACTCAGGACTTTTAATTTGG + Intergenic
1082959789 11:58907192-58907214 AAAACTCAGGATATATGAAGAGG - Intronic
1085112367 11:73899235-73899257 AGAACTCAGGGTAAAGGATTTGG + Exonic
1086281689 11:85196689-85196711 AGAATTCAGGACATTTTATCAGG + Intronic
1087241243 11:95783579-95783601 AGAATTCAGGCTATATTTCTTGG - Intronic
1087383943 11:97445965-97445987 AGGACTCAGGATATACCTTTTGG + Intergenic
1087435656 11:98113740-98113762 AGATGTCAGGATAATTTATTAGG - Intergenic
1088196320 11:107277995-107278017 TGAACTGAGGATAGATTATCAGG - Intergenic
1091245358 11:134089240-134089262 AGCACTTAGGATATTTTGTTTGG + Intronic
1091531577 12:1361747-1361769 AAAACTGAGGATGTAATATTTGG + Intronic
1093670328 12:21866741-21866763 AGGACTGAGGACAAATTATTGGG + Intronic
1095635332 12:44426156-44426178 AGGGCTCAATATATATTATTAGG + Intergenic
1099456822 12:82873413-82873435 AGTAATCAGGATATCTTCTTTGG + Intronic
1099469772 12:83033453-83033475 CGAACTCAGAATATATTTTATGG - Intronic
1099671899 12:85704891-85704913 AATACACAGGATATATTCTTAGG - Intergenic
1099706692 12:86162919-86162941 AGAACTAAGCATATAGTATTTGG - Intronic
1100016088 12:90012445-90012467 AGAAATCATTATTTATTATTAGG - Intergenic
1102091472 12:110192782-110192804 AGAACCCTGGATATTTTACTTGG + Intronic
1102411070 12:112719234-112719256 AGATCTCAAGATATATATTTAGG - Intronic
1102737948 12:115179769-115179791 AGAACTCTGGAATTATTGTTGGG - Intergenic
1102870161 12:116407973-116407995 ATATCTTAGGATAAATTATTGGG + Intergenic
1104108664 12:125686541-125686563 AGAACTCAGAATACAGCATTTGG - Intergenic
1106070889 13:26409841-26409863 AGAGCTCTGTGTATATTATTTGG + Intergenic
1106345327 13:28871582-28871604 ATCACTCAGGATATAGTAGTGGG + Intronic
1106703034 13:32250006-32250028 AGAACTAAGGATGTGTTGTTTGG - Intronic
1109371592 13:61427946-61427968 TGAACTCAGTGTATATTGTTTGG + Intronic
1110752280 13:79128978-79129000 AAAACACAAGATATAATATTAGG - Intergenic
1111531840 13:89546912-89546934 AGAAGGCAGGATATCTTATGTGG - Intergenic
1115523788 14:34259254-34259276 AGAGCACAGGATATAATATTTGG - Intronic
1116244843 14:42396484-42396506 AGAATTCCAGATATATTATTGGG - Intergenic
1117832188 14:59763076-59763098 GGAATTCAGGACATATCATTTGG + Intronic
1119999830 14:79290223-79290245 AGAACTGACGATATATATTTAGG + Intronic
1120681147 14:87481991-87482013 AGAACTCAGAATATTTAAATTGG + Intergenic
1122828771 14:104385308-104385330 AGAACTCAGGAAATATATTCAGG - Intergenic
1125338035 15:38647248-38647270 AGCACTCAGTAAATATTAATTGG + Intergenic
1126266880 15:46765428-46765450 ATATCACAGGATATATTTTTTGG + Intergenic
1128468911 15:67935662-67935684 AGAAATCATGATGTATTACTGGG - Intergenic
1131932829 15:97464708-97464730 CGAATTCAGTATATATAATTGGG - Intergenic
1133882719 16:9798150-9798172 GGAACTCAGTAAATATTTTTAGG + Intronic
1135797149 16:25456698-25456720 AAAAATCAGAATGTATTATTGGG + Intergenic
1135846503 16:25923658-25923680 AGAATTCAGGAAATAAAATTTGG + Intronic
1137877140 16:52007361-52007383 AGAACTAAGCAAGTATTATTTGG + Intronic
1139619701 16:68127925-68127947 AGAACTAAGGCTAAATAATTGGG - Intronic
1141480984 16:84306806-84306828 AGTACTCAGTAAATATTCTTCGG - Intronic
1145853622 17:28129616-28129638 AGAACTTAGAATCTATTATGGGG + Intronic
1148066693 17:44876210-44876232 AGACCTCGGGAAATATTACTGGG + Intronic
1149144894 17:53478617-53478639 AGAACACATAATCTATTATTTGG - Intergenic
1150929987 17:69574040-69574062 ATAACTCTGGTTATATTTTTTGG + Intergenic
1152491238 17:80636002-80636024 AGACCTCAGGATTTTATATTTGG + Intronic
1153698164 18:7664784-7664806 AGATGTCTGGATATATTACTGGG + Intronic
1154148000 18:11882031-11882053 AGAATTTAGGATATTTTATCAGG + Exonic
1155639010 18:27990538-27990560 AGTACTCAAGATTTATAATTAGG - Intronic
1156028788 18:32688957-32688979 AGCCCTCAGGAAATTTTATTTGG - Intronic
1156030101 18:32703184-32703206 AGAACTCAGCACATAGTACTGGG + Intronic
1158387426 18:57011778-57011800 AGAACTCAGCTTTTCTTATTGGG - Intronic
1158737253 18:60096891-60096913 ATAAGTCAGTATTTATTATTAGG + Intergenic
1158755781 18:60322986-60323008 AGATCTCATGTTATATTTTTTGG - Intergenic
1159567475 18:70068813-70068835 AGATCTCAGGATATGTCATGTGG - Intronic
1159773138 18:72572228-72572250 AGAACTAAGGATCCATTATCTGG + Intronic
1160728897 19:631698-631720 AAAACTCAGGAGATACTTTTAGG + Intronic
1163964599 19:20733366-20733388 AGAACTCAGGAAATATCAAGTGG - Intronic
1164290908 19:23867855-23867877 GGACATCAGGATTTATTATTGGG + Intergenic
925481932 2:4285155-4285177 AGAGCTCATGTTATTTTATTGGG - Intergenic
926077700 2:9954662-9954684 GGAACCCAGGGTATACTATTTGG - Intronic
929324834 2:40596553-40596575 GGGTCTCAGGATTTATTATTTGG + Intronic
929507947 2:42543042-42543064 AGAGCTCAGGACAAATTCTTAGG + Intronic
930575620 2:53143259-53143281 ACCACTCAGGATTTACTATTTGG - Intergenic
930864899 2:56112699-56112721 ATAACTCAGGATACATTTGTTGG + Intergenic
933608334 2:84407549-84407571 GGAACTTAGAATTTATTATTAGG + Intergenic
933748194 2:85585648-85585670 TGAAGGCAGGATATTTTATTGGG + Intronic
933789984 2:85876057-85876079 AGAACTCAGGTTGTATGTTTTGG - Intronic
935203539 2:100878754-100878776 AAAACCCAGGTTATATTATTTGG - Intronic
937605260 2:123792931-123792953 AGAAGGCAGAACATATTATTGGG - Intergenic
939755617 2:146105556-146105578 AAAACTCCGGAGATCTTATTGGG + Intergenic
940797691 2:158098113-158098135 AGAACTCAGGATAGGATATAAGG + Intronic
940960445 2:159779596-159779618 AGACTTCAGAATATATTAATAGG - Intronic
943183787 2:184578423-184578445 AGAACTCTGGATACTTTAATTGG - Intergenic
943301595 2:186209534-186209556 AAAACTTAGTATATAATATTGGG - Intergenic
1169779521 20:9294135-9294157 AGAACTCAGGAAAAAATATTGGG - Intronic
1170106618 20:12758826-12758848 ATGACTCAGGATATCTGATTAGG - Intergenic
1170178628 20:13502510-13502532 AAAACTAACAATATATTATTTGG + Intronic
1170277070 20:14603053-14603075 AGAACACATAATAAATTATTAGG + Intronic
1170459987 20:16568334-16568356 AGCACTCAGTAAATATTTTTTGG + Intronic
1171322623 20:24259651-24259673 AGAAACCAGGGTATATTCTTGGG + Intergenic
1173090459 20:39965740-39965762 AGAAGTCATGCTATATTTTTAGG + Intergenic
1177477287 21:21640249-21640271 AGAACTCAGAAATTATTTTTAGG + Intergenic
1178026117 21:28469480-28469502 AGAACACAGGATGAATTATTTGG + Intergenic
1178037069 21:28596783-28596805 AGAAATCATTATATATTACTGGG + Intergenic
1178114389 21:29402354-29402376 AGAACTCAGGAAATTTTAAATGG + Intronic
1182602681 22:31478990-31479012 GGCACACAGGATATATTATGTGG - Intronic
950133871 3:10566860-10566882 AAATTTCAGGATATATTAGTGGG + Intronic
953114823 3:39981874-39981896 GGAACTCAGGAAATATCAATAGG + Intronic
953189637 3:40671993-40672015 AGAACACAGGAGAAAATATTTGG + Intergenic
954110880 3:48432184-48432206 AAAACTCAGGATATTTTAATTGG + Exonic
955615210 3:60800252-60800274 AGAAATCAAGACCTATTATTTGG - Intronic
956618489 3:71197320-71197342 CGGAATCAGGAAATATTATTAGG - Intronic
956946028 3:74224492-74224514 AGAAAACATAATATATTATTTGG - Intergenic
957025429 3:75176518-75176540 AGAAATGAGGATATATAAATAGG + Intergenic
957336311 3:78833607-78833629 AGAATCCAGGATATTTTCTTAGG + Intronic
957782785 3:84841285-84841307 ATAATTCAGGCTATATCATTAGG + Intergenic
957783903 3:84855466-84855488 ACAACACAGGTTATATGATTGGG + Intergenic
959037268 3:101382496-101382518 ACAATTCGGTATATATTATTTGG + Intronic
959541141 3:107540095-107540117 GGGATTCAGGATATATTAGTTGG + Intronic
959861175 3:111216590-111216612 AGAACTCAGGAATTTTTCTTAGG + Intronic
963030769 3:140973051-140973073 AGAACTAAGGAAATTGTATTAGG + Intronic
963447385 3:145430036-145430058 AAAATACTGGATATATTATTGGG - Intergenic
964366565 3:155956863-155956885 AAAATTGAGGAAATATTATTTGG - Intergenic
965605500 3:170494372-170494394 AGAACCCAGGATGTATAAGTGGG + Intronic
966623872 3:181995622-181995644 AGATCACAGGAAATAATATTTGG - Intergenic
968391984 4:200634-200656 CAAACTCAGTAAATATTATTTGG + Intergenic
973755556 4:54070044-54070066 AGAAATCAGGATTTATTCTCTGG + Intronic
973866089 4:55114753-55114775 GGAACTCAGGATATGGTGTTGGG - Intronic
973954171 4:56047174-56047196 AGAACTCCGGCGATATTTTTTGG + Intergenic
974185804 4:58444378-58444400 AAAACTCAGTCTATAGTATTTGG - Intergenic
974356768 4:60822670-60822692 AGAACTCAAGATATATTACTAGG + Intergenic
975079461 4:70258564-70258586 ACAACAAAGCATATATTATTTGG - Intergenic
975182685 4:71364974-71364996 ACAACTCATTATGTATTATTTGG - Intronic
975995939 4:80314998-80315020 AGAACTCAGGACATGTTACAAGG - Intronic
976541480 4:86282083-86282105 AGAACTCAGGAGAAATTTATTGG + Intronic
976947507 4:90788670-90788692 GTAAGTCAGGATATATTATTTGG - Intronic
977033009 4:91911057-91911079 AGAAATTGTGATATATTATTTGG - Intergenic
977359295 4:95982397-95982419 AGCACTCAGAATTTATTATCGGG + Intergenic
977902446 4:102437964-102437986 AGAACTCACCAGATATGATTTGG + Intergenic
977971760 4:103220926-103220948 GGAACACAGGATATATTTTTAGG - Intergenic
978033780 4:103970559-103970581 AGAACTTAGAATATGTTTTTTGG - Intergenic
979828304 4:125267884-125267906 ACAACTCAGGATATATTTATAGG - Intergenic
979883692 4:125996236-125996258 AGAACTCAGAAAATAATATTGGG + Intergenic
982914765 4:161193474-161193496 AAAACTCAGGATTTTCTATTAGG - Intergenic
984415130 4:179448060-179448082 AGACCTCAGGATATAGAACTAGG + Intergenic
984421273 4:179525283-179525305 AGAAATCATTATATTTTATTTGG - Intergenic
985006127 4:185536780-185536802 AGAACTCATCAGATATTATGTGG - Intergenic
985371213 4:189286761-189286783 AGATCTCACGATATATTTTTTGG - Intergenic
987715494 5:21564040-21564062 TTAACTTAGGATATAGTATTAGG + Intergenic
987815396 5:22894556-22894578 ATAACTCAGAAAATATTTTTAGG - Intergenic
987888959 5:23851128-23851150 AGAACTGAGGATATAGATTTTGG - Intergenic
987893100 5:23909055-23909077 AGAACTAAGGATATGTTTTGGGG - Intergenic
987947461 5:24630242-24630264 AGAACTCAGGGAATATTTTAAGG + Intronic
988457773 5:31402636-31402658 AGAATTTAGGATCTATTATATGG - Intronic
989288022 5:39725493-39725515 AGAAATAATGATGTATTATTAGG - Intergenic
992962999 5:81973770-81973792 AATACTCAGGATTTATTTTTTGG - Intronic
994880249 5:105482795-105482817 AGAACTCAGTATACGCTATTTGG - Intergenic
994895364 5:105696407-105696429 AGAATTCAGTTTAAATTATTAGG + Intergenic
995010437 5:107251787-107251809 AGCACTCAGGATATTTTGTGTGG + Intergenic
996533055 5:124546248-124546270 AAAACAAAGGATATATTTTTTGG - Intergenic
998835893 5:146202687-146202709 GGGACTCAGTATATGTTATTGGG + Intergenic
998994772 5:147859356-147859378 AAAATTCAGGATTTATTTTTTGG - Intergenic
999033698 5:148322561-148322583 AAAACTCTGGAAATAGTATTTGG - Intronic
999802871 5:155054014-155054036 AGAAGACAGGATATATTCTCAGG - Intergenic
1003561813 6:7186616-7186638 AGAACTCTGCATGAATTATTTGG + Intronic
1003801973 6:9680507-9680529 AGGACTCACGTTAAATTATTGGG - Intronic
1004862413 6:19818489-19818511 AGAACTTGGGATATTTTATTTGG - Intergenic
1007463996 6:42039176-42039198 AAAACACAGGATACATGATTTGG - Intronic
1009001228 6:57718004-57718026 TTAACTTAGGATATAGTATTAGG - Intergenic
1009866211 6:69400734-69400756 AGAAAAAAGGATAAATTATTGGG - Intergenic
1011111768 6:83845709-83845731 AGAACCCACGATAGTTTATTTGG + Intergenic
1011646748 6:89466122-89466144 AACCCTCATGATATATTATTAGG - Intronic
1011814765 6:91175872-91175894 TGAACTGTGGATAAATTATTTGG - Intergenic
1013171596 6:107641180-107641202 AAAACTTAGAATATATTGTTTGG + Intronic
1013859744 6:114621499-114621521 AGCACACAGCATATTTTATTGGG - Intergenic
1013869394 6:114739113-114739135 AAAACTCAGAATATTTTACTTGG - Intergenic
1013941736 6:115671993-115672015 AGAACTTAGTAAATATTAGTTGG - Intergenic
1016997928 6:149974134-149974156 ATAAATCAGGATATATTGTGCGG - Intergenic
1020522407 7:9208323-9208345 AGTCCTCAGGATATGTTTTTAGG + Intergenic
1021475846 7:21059694-21059716 AGAACTCAGGATAAACATTTTGG + Intergenic
1021677965 7:23099843-23099865 TGAACTGAGGATATATTTTTTGG - Intergenic
1021802728 7:24323995-24324017 AGGACTCAGGGCATATTCTTAGG - Intergenic
1022839237 7:34147207-34147229 ATAACTCAGTGTATATAATTAGG - Intronic
1023685165 7:42726185-42726207 AGAACTCAGGACATATTTTTAGG + Intergenic
1023706013 7:42942574-42942596 GGGACTCAGGATATGTTATGGGG - Intronic
1024967566 7:55037793-55037815 AGAAGTCAGAATCTATTATCTGG - Intronic
1025079333 7:55968227-55968249 AGAACTGGGGATATTTTAATAGG + Intronic
1025745164 7:64236350-64236372 TGAATTCAGGATAAATTTTTTGG - Intronic
1026674074 7:72414818-72414840 GGAATTCAGGATATATATTTGGG - Intronic
1027308368 7:76926526-76926548 ATAACTGAGGTTATATTCTTAGG - Intergenic
1028281103 7:88929056-88929078 AGAAATCAGGAAATATTCTGAGG - Intronic
1030285565 7:107823481-107823503 AAAACTAAGAATATCTTATTGGG - Intergenic
1031452491 7:121938833-121938855 AGAATTCAGGATGCATAATTAGG - Intronic
1031702220 7:124941002-124941024 AGAACTGAAGATATAAAATTGGG - Intergenic
1031910197 7:127508394-127508416 ATCACACAGGATATTTTATTTGG + Intergenic
1032627861 7:133612112-133612134 AACACTTAGGATATATTATTAGG + Intronic
1033466838 7:141599531-141599553 AGAAATCAGGTTAGAATATTTGG - Intronic
1035005903 7:155660416-155660438 AGACTTCAGCATATATTTTTTGG + Intronic
1036454931 8:8898145-8898167 AGAAAACAGGATATATTAAAAGG - Intergenic
1037341592 8:17851500-17851522 AGAACACAGGATACAGTCTTGGG + Intergenic
1040725581 8:50378474-50378496 AGAACTCAGGATCTATCAACTGG - Intronic
1040792079 8:51243215-51243237 CCAACTCAGGATATATTTTAGGG + Intergenic
1042892588 8:73629285-73629307 ATAACTCAAGATTTAATATTGGG - Intronic
1044030970 8:87236881-87236903 AGCACACAGTATATATTTTTTGG + Intronic
1045306366 8:100960054-100960076 AAAACTCATGATATTTTAATGGG + Intergenic
1045352361 8:101353344-101353366 AGAACTCAGGAGATGTCAGTGGG + Intergenic
1045934848 8:107667236-107667258 GGTACTCAGGAAATATTTTTTGG + Intergenic
1046698080 8:117365098-117365120 AGCATTCAGGATTCATTATTAGG - Intergenic
1048691324 8:136967887-136967909 ATAACTGAGGATATAGTAATAGG - Intergenic
1048983277 8:139714757-139714779 AGAACTCAGGCTGTGTTCTTGGG + Intergenic
1050297813 9:4223796-4223818 AGTACTAAGGATATTTTATGAGG + Intronic
1051104406 9:13562580-13562602 AGAACTCAGTATATATTCACAGG - Intergenic
1051851232 9:21511401-21511423 GGAAGTCAGCATATTTTATTGGG - Intergenic
1053120410 9:35542597-35542619 ACAACTCAGGTTATTTTAATGGG + Intronic
1055152959 9:73025082-73025104 AGAACTCAAGATATATGTGTGGG - Intronic
1055277041 9:74629632-74629654 AGAAATCAGGATAAATTATGAGG - Intronic
1055525734 9:77131763-77131785 AGAGCTCTGGATATATTAATTGG + Intergenic
1056454121 9:86743956-86743978 AAAATTCAGGATATATGTTTTGG - Intergenic
1056834061 9:89940235-89940257 AGAAATCAGGATATAATAAGTGG + Intergenic
1057901489 9:98952276-98952298 AGTACTCAGGGAATATTATAGGG + Intronic
1058252008 9:102710792-102710814 AGTACTCAGTATGTATTATGGGG - Intergenic
1058598633 9:106644879-106644901 AGAACTCAGGATATGACATAGGG - Intergenic
1058743622 9:107968339-107968361 AGAACTCAGAAACTAATATTAGG - Intergenic
1059950088 9:119453469-119453491 AGAGATCAGGCTATAGTATTAGG - Intergenic
1185983372 X:4804135-4804157 AGAATTCTGGATATTTAATTGGG - Intergenic
1186043632 X:5509199-5509221 AGACCTCAGGTTATAATTTTGGG - Intergenic
1187571184 X:20504251-20504273 AGAACTGAAGATATTTTTTTTGG + Intergenic
1188746413 X:33850314-33850336 AGAACTCATGTGATTTTATTGGG - Intergenic
1188766476 X:34098871-34098893 AAAACTCACAATATACTATTAGG + Intergenic
1189138134 X:38571437-38571459 AGAACTCAGTAGATAATAGTAGG + Intronic
1192063633 X:67857516-67857538 AAACCTCTGTATATATTATTGGG - Intergenic
1192087068 X:68110918-68110940 AGCACTCAGGATTTATTACAGGG + Intronic
1195271900 X:103240391-103240413 AGAATTCAAGATATATGCTTAGG - Intergenic
1195645181 X:107222773-107222795 GGAACTGAAGATATATTTTTAGG + Exonic
1195803846 X:108740117-108740139 TGTACCCAGGGTATATTATTTGG + Intergenic
1197381236 X:125743634-125743656 TGTACTCAGTATAAATTATTAGG - Intergenic
1198111791 X:133508698-133508720 AGAACTCAGGATACATCAGATGG + Intergenic
1198125400 X:133638641-133638663 AGAACTCAGCATCTGTTCTTTGG - Intronic
1198719267 X:139597594-139597616 AGAAATCAGGAATTAATATTAGG + Intronic
1201898048 Y:19015254-19015276 AAAAAGCAGCATATATTATTTGG + Intergenic
1202300251 Y:23405978-23406000 AAAACTAACGAAATATTATTTGG + Intergenic
1202570560 Y:26264620-26264642 AAAACTAACGAAATATTATTTGG - Intergenic