ID: 913282225

View in Genome Browser
Species Human (GRCh38)
Location 1:117197359-117197381
Sequence GATATTTTTGACTTTTACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 346}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913282219_913282225 20 Left 913282219 1:117197316-117197338 CCCCCTTCTCATTGCTCTCAGAG No data
Right 913282225 1:117197359-117197381 GATATTTTTGACTTTTACAGAGG 0: 1
1: 0
2: 0
3: 28
4: 346
913282216_913282225 25 Left 913282216 1:117197311-117197333 CCCCTCCCCCTTCTCATTGCTCT 0: 1
1: 1
2: 4
3: 89
4: 1034
Right 913282225 1:117197359-117197381 GATATTTTTGACTTTTACAGAGG 0: 1
1: 0
2: 0
3: 28
4: 346
913282217_913282225 24 Left 913282217 1:117197312-117197334 CCCTCCCCCTTCTCATTGCTCTC No data
Right 913282225 1:117197359-117197381 GATATTTTTGACTTTTACAGAGG 0: 1
1: 0
2: 0
3: 28
4: 346
913282218_913282225 23 Left 913282218 1:117197313-117197335 CCTCCCCCTTCTCATTGCTCTCA No data
Right 913282225 1:117197359-117197381 GATATTTTTGACTTTTACAGAGG 0: 1
1: 0
2: 0
3: 28
4: 346
913282221_913282225 18 Left 913282221 1:117197318-117197340 CCCTTCTCATTGCTCTCAGAGAA 0: 1
1: 0
2: 1
3: 36
4: 341
Right 913282225 1:117197359-117197381 GATATTTTTGACTTTTACAGAGG 0: 1
1: 0
2: 0
3: 28
4: 346
913282220_913282225 19 Left 913282220 1:117197317-117197339 CCCCTTCTCATTGCTCTCAGAGA 0: 1
1: 0
2: 1
3: 28
4: 287
Right 913282225 1:117197359-117197381 GATATTTTTGACTTTTACAGAGG 0: 1
1: 0
2: 0
3: 28
4: 346
913282222_913282225 17 Left 913282222 1:117197319-117197341 CCTTCTCATTGCTCTCAGAGAAC No data
Right 913282225 1:117197359-117197381 GATATTTTTGACTTTTACAGAGG 0: 1
1: 0
2: 0
3: 28
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913282225 Original CRISPR GATATTTTTGACTTTTACAG AGG Intronic
901893511 1:12288665-12288687 GATATTTTTGAGAGTTAAAGGGG + Intronic
904133911 1:28296329-28296351 GACATTTTTGGCTGTTACAGGGG + Intergenic
907129424 1:52082385-52082407 AATTTCTTTGACCTTTACAGGGG + Intronic
908979676 1:69940622-69940644 GATTTTTTTTATTTTTGCAGGGG - Intronic
909766846 1:79366991-79367013 GATATATTAGACTTTCTCAGGGG - Intergenic
910472056 1:87564663-87564685 TATATTTTTAACATTTGCAGGGG - Intergenic
910614357 1:89180799-89180821 TATATTTTTTATTTTTCCAGAGG + Intergenic
911035380 1:93538924-93538946 AATGTTTTTGAGTTTGACAGTGG + Intronic
911250613 1:95572411-95572433 GATCCTTTTGCCTTTTACACAGG + Intergenic
911585656 1:99687653-99687675 GAAAACTTTGAATTTTACAGTGG + Intronic
911680241 1:100707077-100707099 GACATTTCTGTCTTTTACAAGGG + Intergenic
912019478 1:105089020-105089042 GATTTTTTTGATTTTTACTCAGG - Intergenic
913282225 1:117197359-117197381 GATATTTTTGACTTTTACAGAGG + Intronic
914591144 1:149106914-149106936 GATATTTATGACTTTTGTCGGGG - Intergenic
915205861 1:154269998-154270020 GGCATTTTTGACTTTTAAATAGG - Intronic
917168342 1:172139934-172139956 GATATTTTTGTTTTTAAAAGGGG - Intronic
917592922 1:176495738-176495760 GATATTTCTGTCTTTCTCAGTGG - Intronic
918271225 1:182901945-182901967 AATATTTTTCAGTTTTTCAGTGG - Intronic
918330899 1:183459415-183459437 GATAGTTTTGTCTTATAAAGAGG - Intergenic
920719972 1:208378308-208378330 AATATTTTTGAGATTTACAAAGG + Intergenic
920852409 1:209637152-209637174 AATATTTTTGACCTTTAGATGGG + Intronic
921242749 1:213202784-213202806 AATATTTTTGTCTTTTAAAATGG - Intronic
921287348 1:213621236-213621258 GACATTTCTGACTTTTAGTGGGG - Intergenic
921546790 1:216483025-216483047 ATTATTTTTGTCTTTTAAAGAGG - Intergenic
923004666 1:230037533-230037555 AAGATTTTTCAGTTTTACAGTGG + Intergenic
924944341 1:248836026-248836048 GATAGTTTTCACTTTGAGAGTGG + Intergenic
1063438433 10:6053104-6053126 GTTATTTTTGTTTTTTACAAAGG - Intronic
1064335065 10:14432725-14432747 CATATTTATCACTTTTACAATGG - Intronic
1064927282 10:20582780-20582802 TATATTTTTTACTTTTTCAGTGG + Intergenic
1064950669 10:20846186-20846208 GATATTTTTGTTATTTAGAGAGG - Intronic
1066439728 10:35427033-35427055 TATATTTGTGTCTTATACAGAGG + Intronic
1068315249 10:55333609-55333631 TATATTTTAGATATTTACAGAGG + Intronic
1068421355 10:56798414-56798436 GTAATTTTTGACTTCTAAAGAGG - Intergenic
1068957866 10:62836399-62836421 GATATTTTTCATTTTTAAATTGG - Intronic
1069083439 10:64113026-64113048 GATATTTTCTATTTTTAAAGGGG - Intergenic
1069405851 10:68097596-68097618 GATATTTTCCTCTTTTACAGAGG + Intergenic
1070025802 10:72630742-72630764 GATGTTTTTGTTTTTTACAGTGG - Intergenic
1070391429 10:75974059-75974081 CACATTTTTCACTTTTAAAGGGG + Intronic
1071349476 10:84725284-84725306 GGTATTTTTGACTTTAAAAAGGG + Intergenic
1071873051 10:89815965-89815987 GACATTTTTGACATTTCCACTGG + Intergenic
1072960182 10:99922375-99922397 GATATCTCTCGCTTTTACAGAGG + Intronic
1074251534 10:111755587-111755609 GTAATTTTTGACTTTGCCAGTGG - Intergenic
1075198583 10:120382520-120382542 GATATTTTTTCTTTTTTCAGAGG + Intergenic
1076518562 10:131063868-131063890 GAAATCTTTGATTTTTGCAGAGG + Intergenic
1078494907 11:11807936-11807958 GATTTTTTTTTCTTTTACAGAGG + Intergenic
1079843978 11:25440667-25440689 GATATTGTTGAGTTTTATAAAGG + Intergenic
1079968239 11:27004851-27004873 AAAATTTTGGAATTTTACAGAGG - Intergenic
1081497938 11:43634347-43634369 GATTATTTGGACTTTTCCAGCGG - Intronic
1081923333 11:46800084-46800106 GATATTTTACACTTTTATATTGG - Intronic
1082184255 11:49160743-49160765 GATATTTCTAACTTTTAATGTGG + Intronic
1083526629 11:63372500-63372522 CTTGTTTTTGACTTTTACATTGG - Intronic
1085118048 11:73947798-73947820 GATACATTTGACTTTTAAAAAGG + Intergenic
1085293079 11:75414122-75414144 GATAGCTTTGGCTTCTACAGTGG + Intronic
1086535434 11:87838790-87838812 GATATTTTTAAAGTTAACAGAGG - Intergenic
1086682091 11:89684636-89684658 GATATTTCTAACTTTTAATGTGG - Intergenic
1087446706 11:98264211-98264233 GATATTTTAAATTTTTGCAGTGG - Intergenic
1087470033 11:98561536-98561558 GAAATTTGTGCCTTTTGCAGCGG + Intergenic
1088160767 11:106867691-106867713 GAAATTTTTAACTTATTCAGAGG - Intronic
1088643664 11:111898057-111898079 GACATTTTTTATTTTTACAAGGG + Intergenic
1090060568 11:123461005-123461027 CATATTTTTGGCTTTTTAAGAGG + Intergenic
1090601177 11:128373370-128373392 GAAATTCTTGACTTTCTCAGAGG + Intergenic
1091629502 12:2148957-2148979 TATTTTTTTGACTTTTCCAGTGG + Intronic
1091959452 12:4679965-4679987 GAAATGTTTGCCTTTTACAAAGG - Intronic
1092207861 12:6626985-6627007 ATTATTTTTAACATTTACAGAGG - Intronic
1092641216 12:10512662-10512684 GAAATTTTGGAGTTTTTCAGTGG - Intronic
1093208672 12:16281559-16281581 GATATTTTTCTCCTTTATAGAGG + Intergenic
1094125073 12:27014600-27014622 GTTATTTTGTACTTTCACAGTGG - Intergenic
1095202977 12:39407203-39407225 GAGATTTCTCATTTTTACAGTGG + Intronic
1095561964 12:43575891-43575913 GATATGTTGGAAATTTACAGTGG - Intergenic
1095829446 12:46569140-46569162 GACATTTGTGACTTTCTCAGTGG + Intergenic
1096024413 12:48349037-48349059 GACATTTTTAACTTTCCCAGTGG - Intronic
1096328894 12:50691534-50691556 GATATTTTTGAACTTTAGATAGG + Intronic
1098622501 12:72620142-72620164 AATATATTTTACTTTTACAAAGG - Intronic
1099158850 12:79214192-79214214 GATTTTTTTAAATTTCACAGTGG + Intronic
1100418212 12:94401083-94401105 TTTATTTTTTACTTTTAGAGTGG - Intronic
1100518362 12:95349922-95349944 GGTATTTTTGGCTTTTATTGTGG + Intergenic
1100874161 12:98944668-98944690 GATATTTTTCTTTTTTTCAGGGG - Intronic
1103115261 12:118323414-118323436 AATAATTTTGATTTTTACACAGG + Intronic
1103770088 12:123315442-123315464 GAAATTTTTGTTTTTAACAGGGG - Exonic
1104830964 12:131750993-131751015 GACATTTTTGACATTTGTAGTGG + Intronic
1106131259 13:26941343-26941365 GATCCTGTTGATTTTTACAGGGG - Intergenic
1106223484 13:27767262-27767284 ACTATTTTTTACTATTACAGTGG + Intergenic
1106302065 13:28476382-28476404 ATTATTTGTGACTTTTACATGGG + Intronic
1106367659 13:29098151-29098173 GAGATATTTGACTTATACTGTGG + Intronic
1107118181 13:36769484-36769506 GGTTTTATTAACTTTTACAGAGG - Intergenic
1107213265 13:37884676-37884698 GATACTTTTGACATTGAAAGGGG - Intergenic
1107217720 13:37941785-37941807 GATAATCTTTACTTTTAAAGTGG + Intergenic
1107704315 13:43084876-43084898 GTTATCTTTTACCTTTACAGAGG - Intronic
1109152272 13:58859920-58859942 GAAAGTTATGACTATTACAGGGG - Intergenic
1109197907 13:59399005-59399027 GATTTTTTTTCCTTTTATAGAGG + Intergenic
1110051851 13:70912198-70912220 AATATATTTGAATTTTAGAGTGG + Intergenic
1110104834 13:71659244-71659266 CATGTTTTTGACTCTTACTGGGG + Intronic
1110130904 13:72008765-72008787 GAAATATTAGACTTTAACAGTGG + Intergenic
1110378310 13:74820042-74820064 AATATTTTTGAATTTAACATCGG + Intergenic
1110938883 13:81323854-81323876 TATCTTTTTCACATTTACAGGGG + Intergenic
1112127865 13:96489212-96489234 TATATTTTTAACTTTTACCAAGG + Intronic
1112654714 13:101438498-101438520 CACATTTTTTTCTTTTACAGTGG + Intergenic
1112862083 13:103843521-103843543 CATCTTTATGACTTTTTCAGGGG + Intergenic
1112989067 13:105488687-105488709 TATGTTTTTCACTTTTCCAGTGG - Intronic
1113341450 13:109430123-109430145 GACATTTTTGGCTGTCACAGTGG - Intergenic
1115708496 14:36023944-36023966 GGAATTTTAGACTTTTACAAAGG + Intergenic
1116103492 14:40470342-40470364 GGAATTTTTGTCTTTTTCAGGGG + Intergenic
1116373887 14:44172582-44172604 TATATTTTTAAATTTTGCAGTGG + Intergenic
1116757618 14:48967192-48967214 GAGATTTTTGACATTTAACGAGG - Intergenic
1118008502 14:61586785-61586807 TATAATTTTGAATTTTTCAGAGG + Intronic
1118101416 14:62608379-62608401 GTTATTTTTAATTTTTTCAGTGG + Intergenic
1118738679 14:68722127-68722149 GCTTTTGTTGACTTTAACAGGGG - Intronic
1118965192 14:70575637-70575659 CATATTTTTTAGTTTTACTGAGG - Intergenic
1119921443 14:78450281-78450303 GAGATTTTTAACTTTTATAATGG + Intronic
1124206841 15:27728104-27728126 GATATTTTGGGCTTTTAAACTGG - Intergenic
1125011099 15:34876670-34876692 GATTTTTTTCACTTAAACAGTGG - Intronic
1125378209 15:39056833-39056855 GATATTTTAGACTTTCAGAATGG - Intergenic
1126802522 15:52312137-52312159 AAGATTGTTGAATTTTACAGAGG - Exonic
1127552771 15:60057499-60057521 GACAGCTTTGACTTTTAAAGTGG - Intronic
1127783595 15:62336825-62336847 GATATTTTTGTCTTTGAAAGAGG - Intergenic
1128849813 15:70942876-70942898 GATATTTTTGCTTCTGACAGAGG - Intronic
1128854406 15:70995706-70995728 GACATTTTGAACTTTTAAAGTGG + Intronic
1128924115 15:71638147-71638169 GACATTCTTGACTTTCACTGTGG - Intronic
1130837459 15:87664667-87664689 GGTAATTTTCTCTTTTACAGTGG + Intergenic
1134363392 16:13553823-13553845 CATATTTTCCACTATTACAGGGG + Intergenic
1134544888 16:15100605-15100627 GATATTTTTGAATGTTACTGTGG - Intronic
1135362518 16:21827322-21827344 GATGTTTTTGAATGTTACAGTGG - Intergenic
1136947581 16:34672133-34672155 AATGTTTATGACTTTTACATTGG + Intergenic
1136966827 16:34921804-34921826 AATGTTTATGACTTTTACATTGG + Intergenic
1137221964 16:46463498-46463520 AATGTTTATGACTTTTACATTGG - Intergenic
1137580971 16:49633276-49633298 GATATTTTTCCCTTTTACAATGG - Intronic
1139119714 16:64000938-64000960 CATATTTTTGAGTTTTTAAGTGG - Intergenic
1139974621 16:70799570-70799592 GACATTTTTGATTGTTACAACGG + Intronic
1140779316 16:78280002-78280024 GATTTTGATGACTTTTGCAGAGG - Intronic
1144665204 17:17097825-17097847 GATTTGTCTGACTTTTCCAGAGG + Intronic
1146137331 17:30334396-30334418 GAGAAGTTTGACTTTAACAGAGG + Intergenic
1146325021 17:31878779-31878801 AATCTTTCTGACTTTTCCAGAGG - Exonic
1146427748 17:32758986-32759008 GATATTTTTGACTAGTACCTTGG + Intronic
1148234426 17:45958551-45958573 AATATTTATGACTTTTGTAGAGG - Intronic
1148488206 17:48004989-48005011 GACATTTTTTACTTTCTCAGAGG - Intergenic
1149254324 17:54807748-54807770 GATTTATTTTTCTTTTACAGGGG - Intergenic
1149295092 17:55254768-55254790 GATATTTTTCACTCCTTCAGGGG + Intergenic
1153853313 18:9117959-9117981 GATATTTTGGATTTTTACAATGG - Intronic
1153898364 18:9590816-9590838 GATATTTATGACTTTGAGATTGG + Intronic
1154289403 18:13094201-13094223 GATATTCATTAGTTTTACAGTGG - Intronic
1155607678 18:27626007-27626029 TATATTTTTCACTTTTCCATAGG - Intergenic
1156056136 18:33006155-33006177 GTTATTTTAGACTATTACAAAGG - Intronic
1156381225 18:36563226-36563248 CCTATTTCTGATTTTTACAGAGG + Intronic
1158819617 18:61144454-61144476 GATCTTTTTGATTTTTCCATTGG + Intergenic
1159186376 18:64980579-64980601 TTTATTTTTTACTTTTACAGTGG + Intergenic
1159269030 18:66124794-66124816 AACATTTTTTACTTTTACATAGG + Intergenic
1159409030 18:68045625-68045647 TATATTTTTTACTTTTCCAGCGG + Intergenic
1165547666 19:36555150-36555172 GATATTTTTCTCCTGTACAGGGG - Intronic
1168333467 19:55583190-55583212 ATTATTTTTCCCTTTTACAGAGG + Intergenic
925101682 2:1252187-1252209 GATAATTTGTACTTTTTCAGTGG + Intronic
928788612 2:34922521-34922543 GATATTTTTAGATTTTACATTGG - Intergenic
929181228 2:39041813-39041835 CATATTTATGACTTTGACATAGG - Intronic
929585090 2:43108590-43108612 GACATTTTTGGTTGTTACAGTGG + Intergenic
929652580 2:43696096-43696118 GATATTCTTGAGTTTATCAGCGG - Intronic
929881399 2:45840289-45840311 GATATTTTTGACTTTTGTCAGGG + Intronic
930877456 2:56235063-56235085 GGTATTTTTAGCTTTTACATAGG - Intronic
931030493 2:58169389-58169411 GATATTGTTGACTTTCATATGGG - Intronic
933056982 2:77683025-77683047 GATATTTTTCACTGCTCCAGTGG + Intergenic
933927114 2:87104168-87104190 GATATTTTTCACTGCTCCAGTGG + Intergenic
935728063 2:106041006-106041028 GTTATTTTTCACTTTTAATGAGG + Intergenic
935868949 2:107424151-107424173 CCTATTTTTAACTTTTACATAGG - Intergenic
936558084 2:113513264-113513286 GATATTTTTGACAGTGAAAGAGG + Intergenic
938275303 2:130015337-130015359 GATATTTTTTACCTCTACATGGG + Intergenic
939237907 2:139521105-139521127 GATATATTAGACTTCTAGAGAGG - Intergenic
939796963 2:146656953-146656975 AATTTTCTTGACTTTTATAGTGG + Intergenic
940561320 2:155301038-155301060 GAAATTTTTCACATTTACATGGG - Intergenic
941208475 2:162605096-162605118 GATATTTTTCTGTTTTCCAGTGG - Intronic
941611030 2:167662605-167662627 GATCTTTTTGTCTGTTACAGTGG - Intergenic
942653220 2:178190357-178190379 GACTTTTTTGACTTTTAATGTGG - Intergenic
942777598 2:179602637-179602659 GACATTTTTGCCTTCTACAGTGG + Intronic
942981005 2:182081879-182081901 GATATTTATGACTTTTTATGTGG - Intronic
943438724 2:187899754-187899776 GATATGTTAATCTTTTACAGTGG + Intergenic
943843989 2:192617798-192617820 TATATTTTTGTCTTTTAAAATGG - Intergenic
945543015 2:211112460-211112482 TTTATTTTTAACTTTTACAGGGG + Intergenic
945586788 2:211675403-211675425 CTTATTTTTTCCTTTTACAGAGG - Intronic
946161134 2:217836735-217836757 GATATTTTTGGCTTTCTCTGGGG + Intronic
946898511 2:224349240-224349262 GATATTTTTGGTTGTCACAGGGG + Intergenic
947046511 2:225993162-225993184 ACTATTTTTGAATTCTACAGCGG - Intergenic
947936117 2:234005343-234005365 CATTTCTTTGACTGTTACAGAGG + Intronic
1169698503 20:8419421-8419443 GATTTTTTTTAATTTTACAGTGG + Intronic
1170100981 20:12699228-12699250 GATATTATTTACTTTTAGTGAGG + Intergenic
1173063117 20:39680989-39681011 GATATTGTTGCCTTTTCCTGGGG + Intergenic
1173213021 20:41052212-41052234 GATATTTTTCACTGTTGCACTGG + Intronic
1173313510 20:41921952-41921974 AATTTTTTTGTCTTTTAGAGAGG - Intergenic
1174613314 20:51816915-51816937 AAGATTTTTCAATTTTACAGTGG - Intergenic
1175588663 20:60169316-60169338 GACATTTTCTACTTTTTCAGTGG + Intergenic
1177023535 21:15893502-15893524 GATAATTTTGCCTTTTGCATGGG - Intergenic
1180043164 21:45290914-45290936 CATGTTTTTGACTATTCCAGTGG - Intergenic
1182877843 22:33707839-33707861 GATATTGTTGATTTTTATGGGGG - Intronic
1182967598 22:34536585-34536607 GATTTCTTTGTCTTTTGCAGGGG + Intergenic
1183150133 22:36030355-36030377 GGCATTTTTGATTGTTACAGTGG + Intergenic
1183436569 22:37799379-37799401 GCTATTTTTGAAGTATACAGTGG + Intergenic
1185105243 22:48865319-48865341 GATTTATTAGAGTTTTACAGAGG - Intergenic
949095707 3:83013-83035 GAAATTTTTGACTATTAGAAAGG + Intergenic
949396832 3:3623300-3623322 GATATCGTTGACTTTAACATAGG + Intergenic
950720333 3:14877835-14877857 GACATTTTTGATTGTCACAGTGG + Intronic
951072322 3:18345605-18345627 CATATTTTTGACTTTTTAAGAGG - Intronic
952465574 3:33581444-33581466 AATACTTTTGTCTTTTTCAGCGG - Intronic
952700245 3:36320117-36320139 GATATTTTTAACCTTAACATAGG - Intergenic
953141959 3:40237417-40237439 GACATTTTTGACTGTCACACTGG - Intronic
953434068 3:42864872-42864894 TATACTATTAACTTTTACAGTGG + Exonic
954827177 3:53384183-53384205 GGTATTTTTGAATTTTAGAAAGG + Intergenic
955318963 3:57960752-57960774 GACATTTTTGACGGTCACAGTGG - Intergenic
955835106 3:63046038-63046060 TATATTTTTTACTTTTATCGAGG - Intergenic
956488074 3:69742234-69742256 GACATTTGTGATTGTTACAGTGG + Intronic
959871282 3:111331279-111331301 CATAGTTTTTACCTTTACAGTGG - Intronic
959990960 3:112631608-112631630 GATATTTATGACTATTACCTTGG + Intronic
960800108 3:121530156-121530178 GATTTTTTTTTATTTTACAGTGG + Intronic
962418270 3:135203575-135203597 GATATTTATAACTTTTTAAGGGG - Intronic
963703204 3:148652777-148652799 AATATATTTGATTTTTACAATGG - Intergenic
964744061 3:159995694-159995716 AGTATTTTTGACATTTACTGTGG + Exonic
964760173 3:160128028-160128050 GATAATTTTAATTTTCACAGAGG + Intergenic
965107819 3:164380502-164380524 AATATTTTTAGATTTTACAGTGG + Intergenic
965382345 3:168005509-168005531 GATATATTTGAAATTAACAGTGG + Intergenic
965588484 3:170340788-170340810 GAGATTTTACACTTTCACAGTGG - Intergenic
965780897 3:172284939-172284961 GATCTTCTTGATTTTCACAGTGG - Intronic
967495139 3:190134764-190134786 GATATTTTTAAAATTTTCAGTGG - Intergenic
969263415 4:6047859-6047881 GATTTGTTTGCCTTTTACACTGG - Intronic
970060951 4:12033798-12033820 TATATTTTTGACTTCTTCTGGGG - Intergenic
970730759 4:19100869-19100891 GCTGTTTTTCACTTTTTCAGTGG - Intergenic
970957071 4:21825315-21825337 TTTATTTTTGACTTTTACAAAGG + Intronic
971465580 4:26956045-26956067 TATTTTTCTGACTTTTACACTGG - Intronic
971565315 4:28131886-28131908 GATATATTTGAAATTAACAGTGG + Intergenic
972005828 4:34103413-34103435 GATATTTTTGACTATGAAAAGGG + Intergenic
972182697 4:36488495-36488517 GACATTTTTGTCTTATAAAGTGG + Intergenic
974247905 4:59345299-59345321 GACATTGTGGACTATTACAGTGG - Intergenic
974441264 4:61921311-61921333 GACATTTTTGTCTATTTCAGTGG + Intronic
974671581 4:65036618-65036640 GACATTCTTGACTCTTCCAGAGG - Intergenic
974908832 4:68090595-68090617 GATATTTGTGACTTTAAAAGAGG + Exonic
975041420 4:69747967-69747989 GATATTCTGGTCTTTTTCAGGGG + Intronic
975133638 4:70852580-70852602 GATATTTAAGACTTTTTGAGAGG - Intergenic
975233865 4:71968511-71968533 TAAACTTTTGACTTTTACAGTGG + Intergenic
975259756 4:72284077-72284099 GGTATTTCTGACTTTCTCAGAGG + Intronic
976386118 4:84460650-84460672 AATATTATTGAGTTTTATAGAGG - Intergenic
977074479 4:92435397-92435419 GATAGATGTGCCTTTTACAGTGG + Intronic
977787371 4:101053228-101053250 AATTTATTTGATTTTTACAGTGG - Intronic
978149786 4:105419492-105419514 CATTTTTTAGACTTTTACAGTGG + Intronic
978429824 4:108621896-108621918 GATTTTATTTACTTTTACAATGG + Intronic
979286756 4:118934621-118934643 GAAATTTATGGCTTTTAGAGTGG + Intronic
979740185 4:124139805-124139827 GATTTTTTTGACTTGTACATGGG - Intergenic
979928382 4:126596794-126596816 AATATTTTTAACTTTTAAATGGG + Intergenic
979981461 4:127261078-127261100 GATATCATTGTCTTTTAGAGAGG - Intergenic
980577464 4:134703260-134703282 TATATTTTTAATTTTTACAATGG + Intergenic
982038456 4:151370718-151370740 GATATTTTTGATTGTCACGGTGG + Intergenic
983624473 4:169789254-169789276 GATATTTTTGAAATATCCAGGGG - Intergenic
984966791 4:185146364-185146386 ACTGTTTTTGACTTTTAAAGTGG - Intronic
985306845 4:188552183-188552205 GGCATTTTTGACTTTTACGTTGG - Intergenic
985977759 5:3434444-3434466 GATTTTTCTGATTTTTCCAGTGG - Intergenic
988145300 5:27298346-27298368 GATATTTTTAACCATTAGAGGGG - Intergenic
988245947 5:28681766-28681788 CATATTTTTAACTATTAAAGTGG + Intergenic
989782271 5:45281986-45282008 AATTTTATTGACTTTTACACTGG + Intronic
991929178 5:71735191-71735213 GATGTTTTTGACTTTAAAAATGG - Intergenic
993695078 5:91051780-91051802 GATATTTTTGACTTAAAATGGGG + Intronic
994440542 5:99797851-99797873 TAGTTTTTTTACTTTTACAGTGG - Intergenic
994637498 5:102362147-102362169 GGTTTTTTTCACTTTTACATTGG - Intergenic
995070155 5:107911817-107911839 TATATTTTTAAATTTTACAAAGG + Intronic
995998087 5:118324458-118324480 GAAATAAATGACTTTTACAGTGG + Intergenic
996130056 5:119770517-119770539 GATATTTTTGACCTTCAGATGGG - Intergenic
999672144 5:153967182-153967204 GAGATTTTTGACTGTTCCTGGGG - Intergenic
999715534 5:154357072-154357094 GATTTTTTTTGCTTTTAAAGGGG + Intronic
1000167199 5:158663380-158663402 AAAATTTTTCAATTTTACAGTGG - Intergenic
1002035060 5:176461950-176461972 AATATTTTTAAACTTTACAGGGG + Intronic
1003209080 6:4043410-4043432 GAAATTTTTGAGTTTTAGAAAGG + Intronic
1003218593 6:4136393-4136415 GATATTTTTGAGTTCTGCTGAGG + Intergenic
1003668005 6:8129445-8129467 GATATTTATGTCTTTTTCAGGGG + Intergenic
1007828999 6:44624258-44624280 AGAATTTTTGTCTTTTACAGAGG + Intergenic
1008761392 6:54855944-54855966 AATATTTTTGATTTGTACAGAGG + Intronic
1009709044 6:67294122-67294144 GAAGTTGTTGACTTTTATAGTGG + Intergenic
1011288171 6:85746976-85746998 GATGTTTAAGACTTTTAGAGAGG + Intergenic
1011327805 6:86170115-86170137 TATATTTTTGATGTTTACATTGG - Intergenic
1011359164 6:86503482-86503504 GATTTATTTGACTCTTAGAGTGG + Intergenic
1011458480 6:87578226-87578248 GTTATTTTTAAGTTTTACAATGG - Intronic
1012874990 6:104715712-104715734 GATAATTTTAACTTTTAAATAGG - Intergenic
1014445858 6:121526574-121526596 CATATTTATGATTTTTACAAGGG + Intergenic
1014483515 6:121969421-121969443 GATTTTTTTTACTTTTAAAAAGG + Intergenic
1015076188 6:129160847-129160869 TATATTTTTGATTTCTACACTGG + Intronic
1016764592 6:147778014-147778036 GATATTTTTAACTTTTTTAAAGG + Intergenic
1020869861 7:13614245-13614267 GATATTTTTAGTTATTACAGTGG - Intergenic
1020927006 7:14341449-14341471 GAGATTTATGACTTTTAAAAAGG + Intronic
1021260149 7:18445908-18445930 GATATGTTTGACTTGTAAACCGG - Intronic
1021438579 7:20651006-20651028 GACACTTTTGTCTTTTGCAGAGG + Intronic
1022328864 7:29358997-29359019 GATATTGTTGATAGTTACAGGGG - Intronic
1023928100 7:44685476-44685498 GATATATTTTACTTATAGAGTGG - Intronic
1024755629 7:52526968-52526990 CATTTCTGTGACTTTTACAGTGG - Intergenic
1024942738 7:54779184-54779206 GATATTATTGACTTGTAAAATGG + Intergenic
1025703802 7:63844288-63844310 CATATTTTTTACTTTTGTAGGGG - Intergenic
1026364219 7:69631313-69631335 GATGTTTTTGACCTTTTGAGAGG + Intronic
1027861836 7:83593834-83593856 TATATTTTTCAATTTTACTGTGG + Intronic
1028424646 7:90672910-90672932 TATATGTTTTACTATTACAGAGG + Intronic
1028515035 7:91668685-91668707 AGTATCTTTGACTTTTCCAGAGG - Intergenic
1029913930 7:104186573-104186595 GATATTTCTGTATTTTTCAGAGG - Intronic
1030963368 7:115955354-115955376 GAAATTTTTAACTTTCACATTGG + Intronic
1031155188 7:118101794-118101816 CATATCTTTGACTTTTACTGAGG - Intergenic
1032763530 7:134967684-134967706 TAGATTTTTGGCTCTTACAGTGG + Intronic
1034134680 7:148755689-148755711 GATATTTTTGCATTTTAAAAAGG + Intronic
1034646112 7:152649363-152649385 GAGATTTTTAAATTTTACACAGG - Exonic
1036913249 8:12777747-12777769 GATGTTTTTGACTTTATCATGGG + Intergenic
1037347803 8:17918299-17918321 GACATTTTTGGTTTTTACAATGG + Intergenic
1037475899 8:19257499-19257521 CATAGTTTTGCCTTTTCCAGAGG - Intergenic
1038026595 8:23596470-23596492 ATTATTTTTGTCTTTTAAAGAGG + Intergenic
1038722662 8:30051207-30051229 GAGATTTCTGACTTGTATAGTGG + Intergenic
1040390375 8:46944712-46944734 GATCTTTCTGACGTTGACAGTGG - Intergenic
1041068976 8:54107975-54107997 TATATTTATGACTTTTATAGTGG - Intergenic
1041643141 8:60224583-60224605 AATATTTTTTTCTTTTTCAGGGG - Exonic
1042212049 8:66390653-66390675 GATAATCTTAACTTTTTCAGAGG + Intergenic
1042658242 8:71125213-71125235 GATATTTTTAACAAATACAGTGG + Intergenic
1042974044 8:74444703-74444725 GATATTTTTGAAATTAAAAGTGG + Intronic
1043068578 8:75609130-75609152 AATATTTTATACTTTAACAGTGG - Intergenic
1043072416 8:75655697-75655719 TATATATTTGACTTTGACACAGG + Intergenic
1043573909 8:81634693-81634715 GATTTATTTGACTTTCAGAGTGG - Intergenic
1043579349 8:81694000-81694022 AATTTATTTGACTTTCACAGTGG - Exonic
1044255466 8:90055134-90055156 ACTATTTTTGTCTTTAACAGAGG - Intergenic
1044538674 8:93385827-93385849 TATTTTTTTTAGTTTTACAGAGG + Intergenic
1045194812 8:99919741-99919763 GATATTTATTAACTTTACAGTGG - Intergenic
1045407159 8:101878451-101878473 TATAATTTTGTTTTTTACAGGGG + Intronic
1045554153 8:103199078-103199100 TATATTTTTCATTATTACAGTGG + Intronic
1045746595 8:105430118-105430140 GATAGTTCTGACCTTTACTGTGG + Intronic
1046507346 8:115152992-115153014 GATTTTTTTAAGTTTTAAAGGGG - Intergenic
1047031388 8:120885549-120885571 TATATTTTTGACTTAAAGAGAGG + Intergenic
1047156425 8:122324512-122324534 GATATTTTTGTCTTTTAAAATGG + Intergenic
1047485203 8:125324257-125324279 TATATGTTTAACTTTTAAAGTGG - Intronic
1047791101 8:128204735-128204757 AATATTTTTGTCTTTTACTCTGG - Intergenic
1048269374 8:133016391-133016413 GACATTTTTGGCTGTCACAGGGG - Intronic
1049894775 9:102997-103019 GATATTTTTGACAGTGAAAGAGG - Intergenic
1050849773 9:10268981-10269003 GATATTTTTGATTGTGACACTGG - Intronic
1050972522 9:11895119-11895141 CATATTTTAGACTTTCACATGGG + Intergenic
1050979086 9:11986016-11986038 TATATTTATGACTTTCACTGAGG + Intergenic
1051033995 9:12720895-12720917 TATATTTCTGAATTTTCCAGTGG - Intergenic
1051587745 9:18745058-18745080 CATATTTATTAATTTTACAGTGG - Intronic
1052722171 9:32185274-32185296 AATATTTGTCACTTTCACAGAGG - Intergenic
1052736801 9:32351004-32351026 GATATATTTAATTATTACAGTGG - Intergenic
1053735982 9:41102993-41103015 GATATTTTTGACAGTGAAAGAGG - Intergenic
1054692391 9:68328406-68328428 GATATTTTTGACAGTGAAAGAGG + Intronic
1054757435 9:68973455-68973477 GATAATTTAGACTTTTTAAGAGG + Intronic
1055002030 9:71462286-71462308 AATATTTTTGAGATTTACTGTGG + Intergenic
1056002894 9:82236226-82236248 GATTTTTTTTTCTTTTAAAGAGG + Intergenic
1056027454 9:82513773-82513795 GATATTTTTCATTTTGAAAGAGG + Intergenic
1056291814 9:85151134-85151156 GATATTTTTGAATTTTTCCTTGG + Intergenic
1056490030 9:87096811-87096833 GATATTTTTGGCTGTTTCACAGG + Intergenic
1056578739 9:87874885-87874907 GACCTTTTGGGCTTTTACAGAGG + Intergenic
1057410761 9:94815011-94815033 ATTATTTTTGTCTTTTAAAGAGG + Intronic
1058684310 9:107466713-107466735 AATATTTCTGACATTTACAACGG + Intergenic
1060537883 9:124405992-124406014 GATAATGTTGTCTTTTAAAGGGG - Intronic
1060984517 9:127812256-127812278 GAGATTTTTTATTTTTAGAGAGG - Intronic
1185801432 X:3014872-3014894 GTTATATTTGACTTTTCCAAAGG + Intronic
1185803778 X:3038117-3038139 GCCATTTTTGATCTTTACAGAGG + Intergenic
1186998746 X:15152790-15152812 CATAGTGTTCACTTTTACAGAGG + Intergenic
1187674064 X:21698325-21698347 GATATTTTTACATTTTACTGTGG + Intergenic
1187722709 X:22168166-22168188 TATATTTTTGCCCTTCACAGTGG + Intronic
1187803360 X:23090152-23090174 GGTATTTTTCAGTTTTATAGTGG + Intergenic
1188153175 X:26704631-26704653 GATATTGTTGACATTTCTAGTGG - Intergenic
1188279992 X:28255389-28255411 GATATTTTTGGTTTTCAAAGGGG - Intergenic
1188362874 X:29278188-29278210 CATATTTTTAGCTTTTACATAGG + Intronic
1189096940 X:38150444-38150466 GATATTTTTGGTTGTCACAGTGG + Intronic
1191047160 X:56150724-56150746 GGTATTTTTGACACTTAAAGAGG - Intergenic
1191669200 X:63733423-63733445 GATGTTTTTGATATTCACAGTGG - Intronic
1192864729 X:75118618-75118640 GATATTTTTTACTTTTGGGGGGG + Intronic
1193049299 X:77083816-77083838 TATTCTTTTGACTTTTCCAGAGG - Intergenic
1194311754 X:92318567-92318589 GATATTTTTTACTCTTGCACTGG + Intronic
1195630309 X:107048980-107049002 GATTTTTTTTCCTTTTAGAGAGG + Intergenic
1196324100 X:114381651-114381673 GATATTTTTGAAATTAATAGAGG + Intergenic
1196906106 X:120436790-120436812 AATATTTTTGTATTTTACATGGG - Intronic
1197692676 X:129520720-129520742 GACACTTTTGTATTTTACAGTGG + Intronic
1197704727 X:129626220-129626242 GTTATTTTTGACTTTTTAATAGG - Intergenic
1198812160 X:140547028-140547050 GATCTTTTTTATTTTTATAGAGG + Intergenic
1199039552 X:143095951-143095973 GATATTTTTTCCTTTTAAAATGG + Intergenic
1200301195 X:154978862-154978884 GATATTTGTGATTTTCTCAGTGG + Intronic
1200620023 Y:5432694-5432716 GATATTTTTTACTCTTGCACTGG + Intronic
1202279842 Y:23171078-23171100 GATAATTCTGATTTTCACAGTGG + Intronic
1202280571 Y:23181920-23181942 GATAATTCTGATTTTCACAGTGG + Intronic
1202281300 Y:23192768-23192790 GATAATTCTGATTTTCACAGTGG + Intronic
1202284591 Y:23225752-23225774 GATAATTCTGATTTTCACAGTGG - Intronic
1202432972 Y:24807152-24807174 GATAATTCTGATTTTCACAGTGG + Intronic
1202436265 Y:24840138-24840160 GATAATTCTGATTTTCACAGTGG - Intronic
1202436993 Y:24850987-24851009 GATAATTCTGATTTTCACAGTGG - Intronic