ID: 913283631

View in Genome Browser
Species Human (GRCh38)
Location 1:117208525-117208547
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913283631_913283633 12 Left 913283631 1:117208525-117208547 CCATTGTCTAGTGCAATATTCAG No data
Right 913283633 1:117208560-117208582 GCTCAGTTAATATTGTTGACTGG 0: 1
1: 0
2: 3
3: 22
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913283631 Original CRISPR CTGAATATTGCACTAGACAA TGG (reversed) Intronic
No off target data available for this crispr