ID: 913288133

View in Genome Browser
Species Human (GRCh38)
Location 1:117246405-117246427
Sequence GAGAATCAGGCAGTTCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913288133_913288138 11 Left 913288133 1:117246405-117246427 CCACCAAGAACTGCCTGATTCTC No data
Right 913288138 1:117246439-117246461 AAGTTCAGAAATTCCTGGAAAGG No data
913288133_913288137 6 Left 913288133 1:117246405-117246427 CCACCAAGAACTGCCTGATTCTC No data
Right 913288137 1:117246434-117246456 GTCTCAAGTTCAGAAATTCCTGG No data
913288133_913288139 22 Left 913288133 1:117246405-117246427 CCACCAAGAACTGCCTGATTCTC No data
Right 913288139 1:117246450-117246472 TTCCTGGAAAGGTTTTTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913288133 Original CRISPR GAGAATCAGGCAGTTCTTGG TGG (reversed) Intergenic
No off target data available for this crispr