ID: 913297059

View in Genome Browser
Species Human (GRCh38)
Location 1:117332340-117332362
Sequence AATTAGCTGCACATGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913297057_913297059 -1 Left 913297057 1:117332318-117332340 CCAGTCTCTACTGAAATACAAAA 0: 126
1: 4903
2: 8166
3: 11078
4: 37801
Right 913297059 1:117332340-117332362 AATTAGCTGCACATGATGGCAGG No data
913297053_913297059 23 Left 913297053 1:117332294-117332316 CCAGCCTGGCCAACATGGTGAAA 0: 87987
1: 159650
2: 173325
3: 160643
4: 141633
Right 913297059 1:117332340-117332362 AATTAGCTGCACATGATGGCAGG No data
913297054_913297059 19 Left 913297054 1:117332298-117332320 CCTGGCCAACATGGTGAAACCCA 0: 2297
1: 100011
2: 177508
3: 201539
4: 146890
Right 913297059 1:117332340-117332362 AATTAGCTGCACATGATGGCAGG No data
913297055_913297059 14 Left 913297055 1:117332303-117332325 CCAACATGGTGAAACCCAGTCTC 0: 1486
1: 69100
2: 142143
3: 132100
4: 79506
Right 913297059 1:117332340-117332362 AATTAGCTGCACATGATGGCAGG No data
913297056_913297059 0 Left 913297056 1:117332317-117332339 CCCAGTCTCTACTGAAATACAAA No data
Right 913297059 1:117332340-117332362 AATTAGCTGCACATGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913297059 Original CRISPR AATTAGCTGCACATGATGGC AGG Intergenic
No off target data available for this crispr