ID: 913297966

View in Genome Browser
Species Human (GRCh38)
Location 1:117340106-117340128
Sequence CCTCTGTTCTTGAGGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913297959_913297966 1 Left 913297959 1:117340082-117340104 CCACATCAGCTGTTTACTCCCTG No data
Right 913297966 1:117340106-117340128 CCTCTGTTCTTGAGGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913297966 Original CRISPR CCTCTGTTCTTGAGGGAAAA TGG Intergenic
No off target data available for this crispr