ID: 913298004

View in Genome Browser
Species Human (GRCh38)
Location 1:117340532-117340554
Sequence ATTATTTTCTGAGGCATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913298004_913298006 -10 Left 913298004 1:117340532-117340554 CCATTTATGCCTCAGAAAATAAT No data
Right 913298006 1:117340545-117340567 AGAAAATAATTGTTAATGATTGG No data
913298004_913298010 28 Left 913298004 1:117340532-117340554 CCATTTATGCCTCAGAAAATAAT No data
Right 913298010 1:117340583-117340605 TAGAAGACCAATAAAGCTCAAGG No data
913298004_913298009 -3 Left 913298004 1:117340532-117340554 CCATTTATGCCTCAGAAAATAAT No data
Right 913298009 1:117340552-117340574 AATTGTTAATGATTGGGGCAAGG No data
913298004_913298007 -9 Left 913298004 1:117340532-117340554 CCATTTATGCCTCAGAAAATAAT No data
Right 913298007 1:117340546-117340568 GAAAATAATTGTTAATGATTGGG No data
913298004_913298008 -8 Left 913298004 1:117340532-117340554 CCATTTATGCCTCAGAAAATAAT No data
Right 913298008 1:117340547-117340569 AAAATAATTGTTAATGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913298004 Original CRISPR ATTATTTTCTGAGGCATAAA TGG (reversed) Intergenic
No off target data available for this crispr