ID: 913298621

View in Genome Browser
Species Human (GRCh38)
Location 1:117346584-117346606
Sequence GGTAATGAGTCAAAAGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913298621_913298629 29 Left 913298621 1:117346584-117346606 CCCAGTGCTTTTGACTCATTACC No data
Right 913298629 1:117346636-117346658 GTAAAGCTGGTTACCTTCAATGG No data
913298621_913298627 16 Left 913298621 1:117346584-117346606 CCCAGTGCTTTTGACTCATTACC No data
Right 913298627 1:117346623-117346645 ACAACCAGATGTTGTAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913298621 Original CRISPR GGTAATGAGTCAAAAGCACT GGG (reversed) Intergenic
No off target data available for this crispr