ID: 913298627

View in Genome Browser
Species Human (GRCh38)
Location 1:117346623-117346645
Sequence ACAACCAGATGTTGTAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913298621_913298627 16 Left 913298621 1:117346584-117346606 CCCAGTGCTTTTGACTCATTACC No data
Right 913298627 1:117346623-117346645 ACAACCAGATGTTGTAAAGCTGG No data
913298619_913298627 18 Left 913298619 1:117346582-117346604 CCCCCAGTGCTTTTGACTCATTA No data
Right 913298627 1:117346623-117346645 ACAACCAGATGTTGTAAAGCTGG No data
913298620_913298627 17 Left 913298620 1:117346583-117346605 CCCCAGTGCTTTTGACTCATTAC No data
Right 913298627 1:117346623-117346645 ACAACCAGATGTTGTAAAGCTGG No data
913298617_913298627 27 Left 913298617 1:117346573-117346595 CCACATCCGCCCCCAGTGCTTTT No data
Right 913298627 1:117346623-117346645 ACAACCAGATGTTGTAAAGCTGG No data
913298623_913298627 -5 Left 913298623 1:117346605-117346627 CCTCTATCCCTTTGCCAAACAAC No data
Right 913298627 1:117346623-117346645 ACAACCAGATGTTGTAAAGCTGG No data
913298622_913298627 15 Left 913298622 1:117346585-117346607 CCAGTGCTTTTGACTCATTACCT No data
Right 913298627 1:117346623-117346645 ACAACCAGATGTTGTAAAGCTGG No data
913298618_913298627 21 Left 913298618 1:117346579-117346601 CCGCCCCCAGTGCTTTTGACTCA No data
Right 913298627 1:117346623-117346645 ACAACCAGATGTTGTAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913298627 Original CRISPR ACAACCAGATGTTGTAAAGC TGG Intergenic
No off target data available for this crispr