ID: 913298629

View in Genome Browser
Species Human (GRCh38)
Location 1:117346636-117346658
Sequence GTAAAGCTGGTTACCTTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913298620_913298629 30 Left 913298620 1:117346583-117346605 CCCCAGTGCTTTTGACTCATTAC No data
Right 913298629 1:117346636-117346658 GTAAAGCTGGTTACCTTCAATGG No data
913298623_913298629 8 Left 913298623 1:117346605-117346627 CCTCTATCCCTTTGCCAAACAAC No data
Right 913298629 1:117346636-117346658 GTAAAGCTGGTTACCTTCAATGG No data
913298626_913298629 -6 Left 913298626 1:117346619-117346641 CCAAACAACCAGATGTTGTAAAG No data
Right 913298629 1:117346636-117346658 GTAAAGCTGGTTACCTTCAATGG No data
913298621_913298629 29 Left 913298621 1:117346584-117346606 CCCAGTGCTTTTGACTCATTACC No data
Right 913298629 1:117346636-117346658 GTAAAGCTGGTTACCTTCAATGG No data
913298624_913298629 1 Left 913298624 1:117346612-117346634 CCCTTTGCCAAACAACCAGATGT No data
Right 913298629 1:117346636-117346658 GTAAAGCTGGTTACCTTCAATGG No data
913298625_913298629 0 Left 913298625 1:117346613-117346635 CCTTTGCCAAACAACCAGATGTT No data
Right 913298629 1:117346636-117346658 GTAAAGCTGGTTACCTTCAATGG No data
913298622_913298629 28 Left 913298622 1:117346585-117346607 CCAGTGCTTTTGACTCATTACCT No data
Right 913298629 1:117346636-117346658 GTAAAGCTGGTTACCTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913298629 Original CRISPR GTAAAGCTGGTTACCTTCAA TGG Intergenic
No off target data available for this crispr