ID: 913300671

View in Genome Browser
Species Human (GRCh38)
Location 1:117366738-117366760
Sequence GCGGCGCGAGGCCGGAGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 344}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913300671 Original CRISPR GCGGCGCGAGGCCGGAGCCC GGG Intergenic
900117424 1:1034530-1034552 GGGGCGCAGAGCCGGAGCCCCGG + Intronic
900119032 1:1040885-1040907 GCGGGGCGGGGCCGGTGCCTGGG + Intronic
900180516 1:1309036-1309058 GGTGAGCGAGGCCGGACCCCGGG - Intronic
900240683 1:1615935-1615957 GCGGCGCGCGGCAGGCGCTCTGG + Intronic
900307812 1:2019574-2019596 CCGGCGCGAGCCCCGGGCCCCGG + Intronic
900344691 1:2205156-2205178 GCGGGGCGTGGGGGGAGCCCGGG - Intronic
900369237 1:2324028-2324050 GAGAGGCGAGGCCGCAGCCCAGG - Intronic
900511682 1:3063760-3063782 GCCGCGCGCGGGCGGGGCCCTGG - Intergenic
900513014 1:3069318-3069340 GCGCCGCGCCGCCGGGGCCCGGG + Intronic
900573675 1:3372510-3372532 CCGGGGTGAGGCGGGAGCCCAGG - Intronic
900668432 1:3832775-3832797 GAGGCGAGAGGCTTGAGCCCAGG - Intronic
901109841 1:6785655-6785677 GCGGCGCCGGGCGGGAGCGCGGG + Intronic
901381815 1:8879153-8879175 GCGGCGCGAGGCAGGAGGGGCGG - Intronic
901417783 1:9129231-9129253 GCGGCGCGTGGGCGGGGCTCAGG - Intergenic
901436054 1:9248067-9248089 GCGGCGCCAGGCCTGAGTGCTGG - Intronic
901703987 1:11059957-11059979 GCGGCGCGGGGCGCGGGCCCGGG + Exonic
901930853 1:12595539-12595561 GCGGGGCGAGGCTGGGGTCCTGG + Intronic
902515319 1:16986751-16986773 GCGGAGGGAGGGAGGAGCCCTGG - Intronic
902615795 1:17622961-17622983 GCGGGGTGAGGCCGCAGGCCAGG - Intronic
903166648 1:21524989-21525011 CAGGCTCGAGGCCAGAGCCCTGG - Intronic
903250994 1:22052985-22053007 GGGGCGCGCGGCCGGGGCTCGGG + Intronic
903739280 1:25549320-25549342 GAGGCTGGAGGCCAGAGCCCCGG + Intronic
904199878 1:28812630-28812652 GCGCCGCAGGGCTGGAGCCCGGG + Intronic
905694540 1:39965164-39965186 GAGGCTGGAGGCTGGAGCCCAGG - Intronic
906143259 1:43546001-43546023 GAGGGGCGAGGTCGGAGCCAAGG + Intronic
906524335 1:46485747-46485769 GCGGCCCGCGGCCGGGCCCCCGG + Intergenic
907051071 1:51330330-51330352 GCGGCCCCAGGCCGGTGCGCGGG + Intronic
907689217 1:56645535-56645557 GAGGGGAGAGGCGGGAGCCCCGG + Intronic
908714284 1:67053735-67053757 GCGGCGCGGCGCCGGCTCCCTGG - Intronic
910318730 1:85919585-85919607 GAGGCGGGAGGCTTGAGCCCAGG + Intronic
910777856 1:90893747-90893769 GCGGCGCCAGGCCTGAGCGGTGG - Intergenic
910935527 1:92483006-92483028 GCGGGGCGAAGGCGGAGCCCCGG - Exonic
913048055 1:115089940-115089962 GCGCCGCGGAGCCGCAGCCCTGG - Intergenic
913300671 1:117366738-117366760 GCGGCGCGAGGCCGGAGCCCGGG + Intergenic
914817135 1:151071226-151071248 GCGGCGCGGAGCCGGGGCCGAGG + Intronic
915937826 1:160099088-160099110 GCGGGGCGAGGCCGGGGTCCAGG - Intergenic
917869549 1:179229448-179229470 GGAGCCCGAGGCCGGAGCCGAGG - Exonic
919789771 1:201283665-201283687 GTGGCGCGCGGCCGGGGCCTAGG - Exonic
919830867 1:201539305-201539327 GCGGCGCGGACCCGGAGCCCGGG + Intergenic
920375392 1:205505327-205505349 GGGGTGGGAGGCCGGAGCCCTGG + Intronic
920511799 1:206557298-206557320 GAGGCGCGAGCCGGGCGCCCGGG + Intronic
920655120 1:207868902-207868924 CCGGAGCGCGGCCGGGGCCCTGG + Intergenic
920805660 1:209231685-209231707 GGGGCGCGGGGCTGGACCCCCGG + Intergenic
921155159 1:212433228-212433250 GCGGCCCGCGGCGGGCGCCCTGG + Intronic
921355608 1:214281573-214281595 GCAGCGCGGGGCCGCAGCGCGGG - Intronic
923026482 1:230208603-230208625 GAGGCCCAAGGCCTGAGCCCTGG + Intronic
923171505 1:231421651-231421673 GCGGCGCGGGGCCGGAATGCTGG + Exonic
923372654 1:233328331-233328353 GCGGCGCGGGGCTGGCGGCCGGG - Exonic
923429285 1:233905166-233905188 CGGGCGGGAGGCCGGAGCGCCGG + Intronic
923631005 1:235649634-235649656 TGGGCGCCCGGCCGGAGCCCCGG - Intronic
923711988 1:236395351-236395373 GAGGCGCGGGGCGGGAGCCGGGG - Intronic
924560608 1:245154592-245154614 GCTGCGCGAGCCTGGAGCCCGGG - Intergenic
924953476 1:248906538-248906560 GGGGTGCGAGGCCGGAGGCCGGG + Intronic
1064354409 10:14604335-14604357 GCGGCGCGAGGGCGGCTCCGGGG + Intronic
1065099552 10:22320710-22320732 GCGCCGCGGCGCCGGAGCCTGGG + Intronic
1065186316 10:23173758-23173780 GGCGCGCGGGGCCGGAGCACCGG + Intergenic
1065214690 10:23438858-23438880 GCGGGGCGAGGCCGGGGGCGCGG - Intergenic
1065993118 10:31031923-31031945 GCGGGGCGAGGGCGGAGCCTGGG - Exonic
1067935036 10:50603290-50603312 CTGGTGAGAGGCCGGAGCCCAGG + Intronic
1071966473 10:90857701-90857723 GAGGCGCGTGGCCGGGGCGCCGG - Intergenic
1072714056 10:97737527-97737549 GCGGCGCCAGGTATGAGCCCAGG - Intronic
1072750454 10:97975015-97975037 GCGGGAGGAGGCCGGAGCGCGGG + Intronic
1074503120 10:114043991-114044013 GCGGCGCGGGGCCGGAGGCATGG - Intergenic
1074753735 10:116609735-116609757 GCGGCGCGGAGGCGGGGCCCAGG + Intergenic
1076171580 10:128324346-128324368 GCGGCCAGAGGTCGGAGGCCTGG - Intergenic
1076306159 10:129467065-129467087 GCGGAGCTGGGGCGGAGCCCGGG - Intergenic
1076722222 10:132397594-132397616 GGGGCGCGGGGCCGGGGTCCCGG + Intronic
1076750035 10:132537916-132537938 CGAGCGCGAGGCCGGAGCCCCGG + Exonic
1076895462 10:133309194-133309216 GCGGGGCGGGGCCGGAGCCTGGG + Intronic
1076945028 10:133640729-133640751 GCTGCGCGGGGCCGGAGCGGGGG - Intergenic
1077068105 11:653808-653830 ACGGAGCCAGGCAGGAGCCCCGG + Intronic
1077124421 11:926102-926124 GCGGCGTGGGGCCGGGGCCGGGG + Intronic
1077303189 11:1856460-1856482 GCGGTGGGAGGCCGCTGCCCAGG + Intronic
1077378021 11:2214754-2214776 GCTGCCCCAGGCCCGAGCCCCGG + Intergenic
1077390205 11:2297273-2297295 GGGGCAAGAGGCCGGGGCCCAGG - Exonic
1077637702 11:3855129-3855151 GAGGCGCGAGGGCGGAGCCTGGG + Intronic
1079296681 11:19241181-19241203 GCTGCGCGGGGCCTGAGCGCGGG + Intronic
1080387325 11:31817779-31817801 CCGGGCCGGGGCCGGAGCCCGGG + Intronic
1080388239 11:31822831-31822853 GCTGGGCGAGGCCTGGGCCCAGG + Intronic
1080540351 11:33258175-33258197 GCCGCGCCTGGCCGGGGCCCGGG + Intronic
1081525396 11:43924536-43924558 GAGGCCGGAGGCCGGAGGCCGGG + Intergenic
1081591620 11:44427120-44427142 TCAGCCCGAGGACGGAGCCCAGG - Intergenic
1082986055 11:59172243-59172265 CGGGCGCGCGGCCCGAGCCCCGG - Intronic
1083033486 11:59615483-59615505 GCGGCGGGAGGCCCGGGCCCGGG - Exonic
1083246050 11:61429423-61429445 GCGGCGCGAGGCCGGGGGCGGGG - Intronic
1083579049 11:63813435-63813457 GCGGCGGGGGGCAGGGGCCCCGG + Exonic
1083613704 11:64016263-64016285 GCGGATCGGGGCTGGAGCCCAGG - Intronic
1083648219 11:64185468-64185490 CCGGGCCGAGGCCGGAGCGCTGG + Exonic
1083821305 11:65172785-65172807 GCGGCGAGAGGCCAGGGCCCCGG - Exonic
1083952052 11:65961978-65962000 GCGGCGCGGGGCCGAAGCTGAGG + Exonic
1084110853 11:67013475-67013497 GAGGAGAGAGGCAGGAGCCCTGG - Intronic
1084150279 11:67284962-67284984 GCGGGGCGAGGGCGAGGCCCCGG + Exonic
1084510313 11:69599228-69599250 GTGGGGCCAGGCCAGAGCCCAGG + Intergenic
1090190392 11:124762755-124762777 GCAGGGAGAGGCCGGAGCGCCGG + Intergenic
1090835450 11:130450200-130450222 GCGCCGAGGGGCCGGAACCCAGG + Intronic
1091640153 12:2230150-2230172 GCGGCTCCAGGTCGCAGCCCCGG - Intronic
1091721994 12:2820531-2820553 ACGGTGCCAGGCAGGAGCCCTGG + Intronic
1093638818 12:21501962-21501984 GCGGCTCGAGGCGGGGGCCCCGG - Intronic
1094375426 12:29783810-29783832 GCCGCGCGCCGCCGGGGCCCCGG - Exonic
1094493815 12:30977275-30977297 GCGGAGCGGGGGCGGTGCCCAGG - Intronic
1095310574 12:40692777-40692799 GGTGCGGGATGCCGGAGCCCTGG + Intronic
1100444603 12:94649866-94649888 GCGGTGCGCAGCCGGAGCGCGGG - Intronic
1102025830 12:109713987-109714009 ACGGCGCGAGGCTGCGGCCCCGG + Intergenic
1103615381 12:122148477-122148499 AGGGAGCGAGGCCGGTGCCCTGG + Intergenic
1103691033 12:122774567-122774589 CGGGGGCGAGCCCGGAGCCCCGG - Exonic
1103948427 12:124539550-124539572 GGGGCGCGAGGATGGAGGCCCGG - Intronic
1104655772 12:130572862-130572884 GTGGAGCGAGGCAGGAGCCAGGG + Intronic
1104826208 12:131711273-131711295 GCGGCGCGAAGGAGGAGGCCGGG + Exonic
1105492638 13:20903051-20903073 GCACCGCGAGGCCGGGGCGCCGG - Intergenic
1105691822 13:22848564-22848586 GCCGCGCGTGGCTGGAGCTCTGG + Intergenic
1106182677 13:27381898-27381920 GGGGCACGGGGCAGGAGCCCGGG + Intergenic
1107978650 13:45713922-45713944 GGGAGGAGAGGCCGGAGCCCTGG - Exonic
1108541643 13:51452216-51452238 ACCGCCCGGGGCCGGAGCCCGGG + Intronic
1111822204 13:93227842-93227864 GCAGCGGGAGGCGGGAGCCAGGG - Intronic
1112504695 13:99968872-99968894 GTGGCCCGAGGCGGGAGCCTTGG - Intronic
1113378908 13:109786073-109786095 GCGGCCCGGGCCCGGCGCCCAGG + Exonic
1113775600 13:112943383-112943405 GCGGCGCGGAGCCGGGGACCGGG - Intronic
1113931897 13:113973020-113973042 GCAGCGGGAGGCAGGAGGCCCGG + Intergenic
1117680697 14:58200133-58200155 GCGGGGCGGGGCCGGGGCTCCGG - Exonic
1118849816 14:69574549-69574571 TTGGCGCGGGGCCGAAGCCCAGG - Exonic
1119454103 14:74739438-74739460 GAGGTGAGAGGCCTGAGCCCAGG + Intergenic
1119539109 14:75427603-75427625 GACGCGAGAGGCCGGAGCCGGGG - Intergenic
1121074926 14:91060231-91060253 GGGGCGCGGGGCCGCAGCCGTGG - Intronic
1122126520 14:99581448-99581470 GGGGAGCGAGGCCAGACCCCAGG - Intronic
1122152183 14:99731272-99731294 CCGGGGTGAGGCTGGAGCCCGGG - Intergenic
1122178775 14:99939609-99939631 GCCGCGCCAGCCCTGAGCCCTGG + Intronic
1122707451 14:103629802-103629824 GCGGGGCCAGGGCGGGGCCCTGG - Intronic
1123033909 14:105464096-105464118 GGGGCGCCGGGCCAGAGCCCTGG + Exonic
1124109555 15:26773240-26773262 TCGGCCCGAGGCCGGGGCCCTGG + Intronic
1124469154 15:29968356-29968378 GAGGCGGGAGGCCGACGCCCGGG + Intronic
1125685164 15:41559431-41559453 GCGGCCGGGGGTCGGAGCCCGGG + Intronic
1125918644 15:43511099-43511121 GCTGTGCGAGGCCGGAGCCGCGG + Intronic
1129051295 15:72783831-72783853 GCGGCGCCAGGACGGAGCGAGGG + Intronic
1129440796 15:75579460-75579482 GCGGAGCGAGGACGCAGTCCGGG + Intergenic
1129675945 15:77632535-77632557 GAGGCGGGAGGCCGCGGCCCCGG + Intronic
1130517143 15:84634080-84634102 GCGGCGCGGGGCCGGAGTCCTGG - Intergenic
1130531068 15:84748378-84748400 GAGGCGGGAGGCGGGAGGCCGGG + Intergenic
1131060111 15:89399466-89399488 GGGGCTCGAGCCGGGAGCCCCGG - Intergenic
1131214964 15:90529457-90529479 GCGGCTGGAGGCCGGGGGCCTGG + Intergenic
1132426854 15:101724657-101724679 GCGGGGCGGGGCCTGAGGCCAGG + Intergenic
1132500070 16:281164-281186 GCGGCGCAGAGCCTGAGCCCAGG + Intronic
1132555473 16:570114-570136 GCGGCGCGCGGCGGGACCTCGGG + Intronic
1132646782 16:1002922-1002944 GCGACGCGATGCCGGTGGCCTGG - Intergenic
1132877949 16:2148622-2148644 GGGGCGCGAGCCGGGCGCCCGGG + Exonic
1134550731 16:15137310-15137332 GCGGCGGGGGGCCGGAGCAGAGG + Intronic
1134708517 16:16317314-16317336 GCGGCGGGGGGCCGGAGCAGAGG - Intergenic
1134715732 16:16357347-16357369 GCGGCGGGGGGCCGGAGCAGAGG - Intergenic
1134849795 16:17470602-17470624 CCGGCGCGGGGCCGGGGCCGGGG + Exonic
1134951085 16:18351331-18351353 GCGGCGGGGGGCCGGAGCAGAGG + Intergenic
1134959025 16:18394812-18394834 GCGGCGGGGGGCCGGAGCAGAGG + Intergenic
1136141595 16:28292365-28292387 GCGGCGCGCGGCGGGAGGGCGGG + Intergenic
1136272889 16:29158907-29158929 GCGGTGGAAGGCCTGAGCCCTGG + Intergenic
1139383635 16:66549968-66549990 GCGGCCCGGGGCCTGAGGCCGGG + Exonic
1139390721 16:66605137-66605159 GCGGGGCGGGGCCCGAGCCCAGG + Intronic
1139545785 16:67648892-67648914 GCTGCGCTCGGCCGGCGCCCAGG + Exonic
1139549706 16:67666593-67666615 GGCGAGCGAGGCCGGGGCCCAGG - Exonic
1141538474 16:84699962-84699984 GCGGCGCGCGGCCAGTGCGCAGG + Intronic
1142136233 16:88453197-88453219 ACGGGGCGGGGCCGGAGCGCCGG + Intergenic
1142147844 16:88499927-88499949 GAGGAGCGCAGCCGGAGCCCTGG + Intronic
1142285917 16:89171504-89171526 GCGGGGCGGGGCCGGGGCCGAGG - Intergenic
1142349971 16:89575482-89575504 GCTGCGCGGGGCCTGAGCCCGGG - Intergenic
1142395354 16:89828588-89828610 GCGCAGGGCGGCCGGAGCCCTGG + Exonic
1142972136 17:3619885-3619907 GCGCTGGGAGGCCGGAGCCCAGG - Intronic
1143032689 17:3976605-3976627 GCGGCAGGAGACCGGGGCCCTGG + Intergenic
1144527181 17:15999990-16000012 GCGCCGCACGGCCGGGGCCCAGG + Exonic
1145077351 17:19867294-19867316 CCGGGGCGAGGCCGGGCCCCGGG - Intronic
1145236702 17:21213824-21213846 GCGGGGCGGGGCCCGAGGCCGGG - Intronic
1145265099 17:21376265-21376287 TCGGGGCCAGGCCGGAGCCGTGG + Exonic
1146283462 17:31559565-31559587 GGGGCGCGGGGCAGGAGCCGTGG - Intergenic
1147683986 17:42276216-42276238 GCGGGGCGAGCCCTGGGCCCGGG - Intronic
1148744470 17:49910608-49910630 GCGCCGCTGGGCCGGAGCTCGGG - Intergenic
1150002915 17:61452477-61452499 GCGGCGCGGAGTCGGAGCCCCGG + Intronic
1150003310 17:61455257-61455279 TGGGCGAGAGGCCTGAGCCCGGG + Intronic
1150108374 17:62478477-62478499 ACTGCCCGAGGCCGGAGGCCCGG - Intronic
1150221095 17:63496366-63496388 GCAGAGCGAGGCCGTGGCCCGGG - Intronic
1150665377 17:67130980-67131002 GAGGCGAGAGGCTTGAGCCCAGG - Intronic
1150675798 17:67245243-67245265 GCGGCGGGAGGCGGGAGTCGGGG - Intronic
1150802210 17:68291349-68291371 GCGACGCGGGGCCGGGGCGCGGG - Intronic
1151475288 17:74341682-74341704 GGGGCCAGAGGCCGGAGTCCAGG - Intronic
1151725042 17:75878642-75878664 GCGGGCGGGGGCCGGAGCCCTGG - Intergenic
1151802070 17:76384583-76384605 GCGGAGCCAGGCCGGCGCCGAGG + Intronic
1151825080 17:76519473-76519495 GAGGGGCGAGGACAGAGCCCTGG - Intergenic
1152245541 17:79183037-79183059 GCGGCGCGAGGCGGGGGGGCCGG - Intronic
1152463892 17:80455132-80455154 GCGAGAGGAGGCCGGAGCCCAGG - Intergenic
1152579673 17:81160364-81160386 GCGGAGGGAGGCTGGAGACCCGG + Intronic
1153900677 18:9614671-9614693 GCGGGGCGCGGCCGGGGGCCCGG - Intronic
1156350442 18:36297672-36297694 GCCCCCCGCGGCCGGAGCCCGGG + Intergenic
1157095095 18:44680187-44680209 GCGGCGAGCGGCGGGCGCCCCGG - Intronic
1157557329 18:48621471-48621493 GAGGTGCGAGTCCTGAGCCCTGG + Intronic
1158137563 18:54224143-54224165 GGAGCGCGGGGCCGGGGCCCAGG - Exonic
1159798222 18:72868194-72868216 GCTGCGCGCGGCCGGCGCCCCGG + Intergenic
1160567758 18:79797904-79797926 GCGGGGCGGCGCCGGAGTCCGGG + Intergenic
1160719197 19:590077-590099 GGGGCGCGGGCCCGGGGCCCGGG - Exonic
1160768858 19:821613-821635 GGGGCGCGCAGGCGGAGCCCGGG + Intronic
1160827361 19:1086784-1086806 GCCCCGCGAGGTGGGAGCCCGGG + Exonic
1160880105 19:1315817-1315839 GCGGCCTGAGCCCGGAGCCGCGG - Intergenic
1160886889 19:1354430-1354452 GCCGCGGGTGGCGGGAGCCCCGG - Intergenic
1160908946 19:1466004-1466026 GCGGCGAGAGGCAGGAAGCCGGG + Exonic
1160921754 19:1524011-1524033 GCGGGGAGGGGGCGGAGCCCGGG - Intergenic
1161065647 19:2236099-2236121 GGGGCGGGAGGCCGGGGCCGGGG - Intronic
1161150074 19:2702794-2702816 GCTGCGGGAGGCCGGAGCGGGGG + Intergenic
1161403367 19:4078593-4078615 GCTGCCCGAGTCCCGAGCCCGGG + Intergenic
1161820955 19:6531203-6531225 GCCGGGCGAGGCGCGAGCCCCGG - Exonic
1162395534 19:10416527-10416549 GCGGCGCGTGGTCCGAGCCGGGG - Intronic
1162426875 19:10602422-10602444 GAGGGGCGGGGCCGGGGCCCGGG + Intergenic
1163102595 19:15107376-15107398 GGGCGGCGCGGCCGGAGCCCGGG + Intergenic
1163243050 19:16076202-16076224 GCGGGGCCAGGCCGGAGCCCCGG + Intronic
1163427140 19:17245888-17245910 GCAGCGCGAGGCCGGCGCGCGGG - Exonic
1163484144 19:17576530-17576552 GCGGAGTGAAGCTGGAGCCCAGG + Intronic
1165080164 19:33302291-33302313 GCTGCGCGGGGCCCGCGCCCCGG + Exonic
1165080258 19:33302610-33302632 GCGCCGCGCCGCCGCAGCCCGGG - Intergenic
1165156256 19:33790588-33790610 GCGGCTCAAGGGAGGAGCCCTGG - Intergenic
1165431879 19:35777553-35777575 GCAGCGCGGGTCCAGAGCCCCGG - Intronic
1165851454 19:38852219-38852241 GCCGCGCGCGGCCGGGGGCCAGG - Intronic
1166294787 19:41883508-41883530 ACGGTGCGAGGCCGGGGCCAAGG + Intronic
1166872075 19:45877007-45877029 GCGGCCTGAGGCCCGAGCCTGGG - Intergenic
1167077125 19:47256796-47256818 GCGGGGCGTGGCCAGAGCCTGGG + Intronic
1168007799 19:53505378-53505400 ATGGCACGAGGCTGGAGCCCAGG - Intergenic
1168544564 19:57240147-57240169 GCGGCGCGATGCCTCAGGCCTGG - Intergenic
927215851 2:20667442-20667464 GCGGCGCGCGGCGCGGGCCCGGG - Exonic
929033630 2:37671581-37671603 GCGGGGCTAGCCCGGAGACCCGG - Exonic
929775672 2:44929364-44929386 GCGGCCTGAGGCCGTGGCCCAGG - Intergenic
932288239 2:70554151-70554173 GCGGCGCGAGCCGGGCACCCGGG + Intronic
932593592 2:73081063-73081085 GCAGCGTGTGGCTGGAGCCCAGG - Intronic
937132556 2:119524313-119524335 GCAGCGGCCGGCCGGAGCCCGGG - Exonic
940265125 2:151828319-151828341 CCGGAGGGAGGCCGAAGCCCAGG + Exonic
941951573 2:171161119-171161141 GCCGCGCGGCGCGGGAGCCCGGG + Intronic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
943667717 2:190627939-190627961 GCAGTGCGAGGGCGGAGCCGCGG - Intergenic
944412626 2:199458454-199458476 GCGGCGCGAGGCGGTGGCCGCGG + Intronic
946185530 2:217978662-217978684 GCGGGGCGGGGGCGGTGCCCGGG - Intronic
946311195 2:218883524-218883546 GCGGGGCGGGGCGGGAGGCCTGG - Intronic
946321992 2:218959795-218959817 GCAGAGCGGGGCCGGCGCCCAGG - Exonic
947912668 2:233811665-233811687 GCAGCGCGAGCTGGGAGCCCAGG + Intronic
948438118 2:237967367-237967389 GCCGGGCGAGGCCAGCGCCCCGG - Intronic
948560455 2:238848160-238848182 GCGGCGCGCGCTCGGCGCCCCGG + Exonic
948566790 2:238892285-238892307 GCGGCACGAGGAGGGGGCCCTGG + Intronic
948824634 2:240568371-240568393 GGGGCGCGGGGCCGGGGCGCCGG - Intronic
948874372 2:240819275-240819297 GCGGCGCGCCCCCGGCGCCCGGG - Intronic
1170226442 20:13995898-13995920 AGGGCGCGAGGCGGGAGCTCGGG - Intronic
1170890061 20:20368802-20368824 GCGGCCCGCGGCCCGGGCCCCGG + Exonic
1172731936 20:37095811-37095833 GGGGAGCGCGGCCGAAGCCCTGG - Exonic
1173865143 20:46308301-46308323 GCTGCGTGGGGCGGGAGCCCCGG + Exonic
1175889996 20:62311789-62311811 GGGGCGGGAGGCCGGAGGCTCGG + Intronic
1175926994 20:62475894-62475916 GGGGCGCGCGGCTGCAGCCCGGG + Intronic
1175962170 20:62642683-62642705 GGGGCGCTCGGCCGGTGCCCAGG - Intronic
1176015044 20:62926570-62926592 GCGGGGCTAGAGCGGAGCCCGGG + Intronic
1176141332 20:63546377-63546399 GCTGGGCAAGGCCTGAGCCCTGG - Intronic
1178277421 21:31251832-31251854 GGTGCGCAAGGCCGGCGCCCTGG - Exonic
1179891736 21:44338918-44338940 GCGGGGAGAGGGCGGAGCCGGGG - Intronic
1179891746 21:44338940-44338962 GCGGGGAGAGGGCGGAGCCGGGG - Intronic
1179985140 21:44916432-44916454 GCGACGTGAGGCCGAGGCCCCGG + Intronic
1180097084 21:45560814-45560836 GCTGAGGGAGGCCCGAGCCCCGG + Intergenic
1181094420 22:20495822-20495844 GAGGCGCGAGGCGGGAGGCTGGG + Exonic
1181710706 22:24685985-24686007 CCGGCGGGAGGCCGAAGCCCAGG - Intergenic
1182321524 22:29480997-29481019 CCTGCGCGGCGCCGGAGCCCTGG - Exonic
1182447273 22:30397188-30397210 ACAGCCCGAGGCGGGAGCCCGGG - Intronic
1182532133 22:30968879-30968901 GCGGCGCGCGGGCGGCGCGCGGG - Intergenic
1183441484 22:37825403-37825425 GCGGCCAGGGCCCGGAGCCCAGG + Exonic
1184320324 22:43736955-43736977 GTGGAGGGAGGCCGGAGCTCAGG - Intronic
1184640240 22:45866721-45866743 GGGACGCGAGGCCACAGCCCGGG + Intergenic
950487705 3:13282754-13282776 GCGGGCCGGGGCCGGGGCCCGGG + Intergenic
951611342 3:24495140-24495162 GCGGCGCGGAGCAGGCGCCCCGG - Intronic
952241193 3:31532837-31532859 GCGCCGCGAGGCCGGCGGACTGG - Exonic
952888378 3:38025226-38025248 GCGGTGCGGGGGCGGAGCCAGGG + Intronic
954245826 3:49330713-49330735 GAGGCTGGAGGCCGGAGGCCGGG + Intronic
954305705 3:49724217-49724239 TCGGGGCGAGGCCGGGGCCGTGG - Intergenic
956761303 3:72447211-72447233 GCGCCGCGAGGGCGGAGGCGGGG + Intergenic
958949400 3:100400736-100400758 GCGCCGGGAGGCCAGAGGCCGGG - Exonic
960586261 3:119323370-119323392 GCGGGGTGTGGCCGCAGCCCTGG - Intronic
962134914 3:132722673-132722695 GCGGGGCGGGGCCGGAGAGCCGG + Intergenic
963168062 3:142225236-142225258 GCCTCCCGAGGCCGGACCCCGGG + Intronic
963897534 3:150703145-150703167 GCGGTGGGAGGCTTGAGCCCAGG + Intronic
964438085 3:156674873-156674895 CCGGCGCGGGGCCGGGGCCGGGG - Exonic
966711974 3:182980615-182980637 GCGGCCCGAGGAGGCAGCCCCGG + Exonic
966862058 3:184236110-184236132 GCGGCGTGAGGCCGGCCCCATGG - Intronic
967859500 3:194140946-194140968 ACGGCGGGGGGCCGGGGCCCCGG - Intergenic
967924141 3:194633231-194633253 GCGGCGCGGGGCCGGGGACCTGG + Exonic
968123845 3:196144221-196144243 GAGGTGGGAGGCCGGAGACCAGG - Intergenic
968434092 4:576141-576163 GCGCCGCGCGGCCGGACCGCCGG + Intergenic
968471998 4:786656-786678 GGAGCGCGAGGCCGAGGCCCAGG - Exonic
968619503 4:1597437-1597459 TCGGGGCCAGGCAGGAGCCCAGG + Intergenic
968815184 4:2818259-2818281 CCGGCGGGAGGCGGGCGCCCGGG + Exonic
969368666 4:6716443-6716465 GCGGCCCGAGGTCGAGGCCCTGG + Exonic
971207469 4:24584287-24584309 GGGGCGCGAGGCGGCAGCTCGGG - Intronic
973867195 4:55125645-55125667 GCGGGGCGGGGCCGGAGCGGAGG + Intergenic
974009331 4:56592791-56592813 GAGGCGCGAGGCCCCAGCCGCGG - Intronic
977908297 4:102501679-102501701 GCGGCGGCAGGCCGGAGCCCGGG - Exonic
978749565 4:112231856-112231878 GCTGCGCGAGGGAGGAGCACCGG - Exonic
982198511 4:152937716-152937738 GCGGCGCGAGGGTGGGGCGCCGG - Intronic
984801803 4:183722990-183723012 GCCGAGCGAGGCGGGCGCCCTGG + Intergenic
984884842 4:184440943-184440965 GCTGTGCGAGGCTGGAGCTCAGG + Intronic
984888714 4:184473411-184473433 ACGGCGCTAGGCCGCGGCCCGGG + Intronic
985068349 4:186144717-186144739 TCGGCGCGGGGCCGGGGCCGGGG + Intronic
985448411 4:190041239-190041261 GCTGCGCGGGGCCGGAGCGGGGG - Intergenic
985657720 5:1140697-1140719 GAGGCGCAAGGGCGGAGCCCAGG + Intergenic
986330578 5:6713827-6713849 GCGGCGGGCGGGCCGAGCCCCGG - Intergenic
987258492 5:16180202-16180224 GGTGCGCGAGGCGGGTGCCCTGG + Intronic
989643204 5:43603205-43603227 GCGCCGCGGGGCCCAAGCCCGGG + Intronic
991291247 5:65035560-65035582 GCGGCGGGAGGCGGGAGGCTGGG + Intergenic
992627532 5:78648823-78648845 GCGGCGCGGGGCCGGGGCCTGGG - Exonic
997568162 5:134905188-134905210 GCGCTGCGAGGCCAGAGCCTAGG + Exonic
997870183 5:137499265-137499287 GCGGCGTGTGGCAGGAGCGCAGG - Exonic
998517704 5:142770703-142770725 GCGGCGGGCGGCCCGGGCCCCGG + Exonic
999218230 5:149954087-149954109 GCCCCGGGAGGCCGGAGCCTGGG - Intergenic
1002176598 5:177404443-177404465 GCGCCGGGAGCCCGGAGCCCTGG + Intronic
1002541172 5:179907540-179907562 GGGGCGCGAGGCCAGGACCCGGG - Intronic
1002888177 6:1313432-1313454 GCGGGGCGAGGCCGGGGCGGCGG - Exonic
1002925809 6:1605105-1605127 GCGGCGCCGGGCCGGAGACCTGG + Intergenic
1005912881 6:30326558-30326580 GCGGCGCCTGGCCAGAGCCGGGG + Intronic
1007327655 6:41073809-41073831 ACGGCGCCGGGCCGGAGACCCGG - Intronic
1010198489 6:73263145-73263167 GCGGCGCGAGCCGGGACCCCTGG - Exonic
1011054980 6:83194183-83194205 GAGGCGGGAACCCGGAGCCCGGG + Intronic
1011517209 6:88166839-88166861 GGGGCGCGAGACCGCACCCCCGG - Intergenic
1013099360 6:106974473-106974495 GTGGCCCGAGGCAGGAGCGCAGG + Intronic
1014272346 6:119349078-119349100 GCGGCGCGGCGCCGGACCACTGG - Exonic
1015149080 6:130019254-130019276 GCGCCGCGGAGCCGCAGCCCAGG + Intronic
1015149332 6:130020205-130020227 GCGGCGCGAGGACGGCCCGCGGG - Intronic
1016328228 6:142927014-142927036 GCGGCGCGGGGCGGGCGGCCAGG + Intronic
1017671991 6:156777773-156777795 GCGGCCGGCGCCCGGAGCCCGGG + Intergenic
1017764133 6:157593162-157593184 GCGGAGCCTGGCGGGAGCCCGGG + Intronic
1017810688 6:157981692-157981714 GCTGCGCGAGGCCGCGCCCCGGG - Intergenic
1019279277 7:192182-192204 GGAGCGCGGGGCCGGGGCCCAGG - Intergenic
1019383528 7:740635-740657 GAGGCGCGTGGCCGGGGTCCTGG - Intronic
1019395721 7:816728-816750 GGGACGCGAGGCGGGGGCCCGGG + Intronic
1019612855 7:1945747-1945769 GCGGCGCTGGGCCGCAGACCGGG + Intronic
1020125255 7:5529839-5529861 GCGGCGCGCGGCAGGAAGCCAGG + Intronic
1023287033 7:38631153-38631175 GCGGAGCGGGGCCGGGGCCAGGG - Intronic
1023881783 7:44325096-44325118 AAGTCGCGAGCCCGGAGCCCCGG + Intronic
1024639360 7:51316849-51316871 GCGGCGCGGGGCGGGGGCGCCGG + Intergenic
1025207309 7:57001241-57001263 GCGGCCCCTGGCAGGAGCCCGGG - Intergenic
1025664628 7:63575645-63575667 GCGGCCCCTGGCAGGAGCCCGGG + Intergenic
1029569958 7:101362900-101362922 GGGGCGAGCGGTCGGAGCCCGGG - Exonic
1032174533 7:129612234-129612256 GCTGCGCGGGACCGGAGCCGCGG + Intronic
1032391209 7:131556487-131556509 GCAGCGCGACTCGGGAGCCCCGG - Exonic
1033186474 7:139231532-139231554 GCGGCGCGAGGCCGAGTACCCGG + Exonic
1034202269 7:149290011-149290033 GCGGAGAGGGGCCAGAGCCCGGG + Intronic
1034426940 7:151018909-151018931 GCGGCGCGAGCCTGGCGCGCTGG - Exonic
1034441211 7:151086851-151086873 GCGGCGCGGGGCCCGGGGCCGGG + Exonic
1038963691 8:32548805-32548827 GCGGCGGGCAGCCAGAGCCCAGG + Exonic
1039212688 8:35235335-35235357 GCGGCGCTGGGCTGGGGCCCGGG - Intergenic
1039502779 8:38030510-38030532 GCGGAGCGAGGCTGGAGGCGCGG + Exonic
1039963216 8:42265506-42265528 GCAGAGAGAGGCCTGAGCCCAGG + Intergenic
1040033092 8:42843514-42843536 GCGGCGGGAGGCCGGATTCCTGG + Intergenic
1041839154 8:62248919-62248941 CGGGCGCGAGCCCCGAGCCCTGG + Intronic
1044934181 8:97277577-97277599 GCAGCGCGAGGCCACAGTCCAGG + Exonic
1045489032 8:102655484-102655506 GGGGCGCGAACCCCGAGCCCCGG - Intronic
1049014523 8:139910182-139910204 GCGGCGGGAAGCCCGAGGCCTGG - Exonic
1049217604 8:141415273-141415295 GGGGAGACAGGCCGGAGCCCTGG + Intronic
1049342739 8:142121939-142121961 GCGCGGCGTGGCCAGAGCCCAGG - Intergenic
1049411453 8:142475651-142475673 GCGGGGCGGAGCCGGAGCCCTGG + Intronic
1049452646 8:142670228-142670250 GGGGCGCGCGGCCTGGGCCCCGG + Intronic
1049507117 8:143008709-143008731 GCGTGGCCAGGCCGGGGCCCTGG + Intergenic
1049635175 8:143684367-143684389 GCGGGGCGAGGCGGGCGGCCTGG + Intergenic
1049765657 8:144354176-144354198 GCGGCGCGGGGCCGGCCCTCAGG + Intronic
1050537752 9:6645344-6645366 GAGGCGCGAGGCCCCAGCCGCGG + Exonic
1051263522 9:15288785-15288807 CTGCCGTGAGGCCGGAGCCCAGG + Intronic
1053055157 9:34989673-34989695 GCGGCGCGGAGGCGGAGCCGTGG + Exonic
1054891795 9:70259318-70259340 CCCGCGCGCTGCCGGAGCCCCGG - Intronic
1056803738 9:89712436-89712458 GCGGAGGGAGGAGGGAGCCCAGG - Intergenic
1057432165 9:95004739-95004761 GCGCGGGGCGGCCGGAGCCCGGG + Intronic
1057432189 9:95004791-95004813 GCGCGGGGCGGCCGGAGCCCGGG + Intronic
1058078257 9:100672749-100672771 GCAGAGCCAGGCTGGAGCCCAGG + Intergenic
1059208420 9:112487279-112487301 GGGGAGCGAGGCCGGAGCGAGGG + Intronic
1060552690 9:124492984-124493006 GCGGGGCCAGGGCGGGGCCCAGG + Intronic
1060594590 9:124840553-124840575 GCGGCACGAGGCCCCAGCCAGGG + Intergenic
1061129948 9:128703066-128703088 GCGTCGCGGGGCCGGGGCCAGGG - Intronic
1061392324 9:130324437-130324459 GCTGCGCGTGGCGGGAGCCAGGG - Intronic
1061843875 9:133376062-133376084 GCGGAGCGAGGCCGGCCGCCGGG - Exonic
1061844057 9:133376647-133376669 GCGGCGAGGGGCCCGCGCCCTGG + Intronic
1061991788 9:134163341-134163363 GCGGGGCGAGGCCGGAGGCCGGG - Intergenic
1062178608 9:135178586-135178608 GGGGCCAGAGGCCGGAGCCCAGG + Intergenic
1062491695 9:136808058-136808080 GCGGCCAGAGGCCGGGGTCCCGG - Exonic
1062493645 9:136821605-136821627 CCGGCCCGAGGCAGGAACCCGGG - Intronic
1062542962 9:137049617-137049639 GCAGGGGGAGGCCGGTGCCCAGG - Intronic
1062601354 9:137319947-137319969 GCGGCCTCAGGTCGGAGCCCAGG - Intronic
1187341468 X:18425413-18425435 GCGGCGCGAGCCCGAACCCCAGG + Intergenic
1187367165 X:18675169-18675191 CCAGGGCGAGGCCGGAACCCCGG + Intergenic
1187648349 X:21374251-21374273 CCGGCACGAGGCCGGAGCCCAGG - Intergenic
1189325000 X:40106561-40106583 GAGGCGGGAGGCGGGAGCGCGGG - Intronic
1192481909 X:71492938-71492960 GCGGAGCAATGCCGGAGGCCGGG - Intronic
1192624521 X:72714015-72714037 GCGGCGCCAGGCCTGAGCGGTGG - Exonic
1197734887 X:129843388-129843410 GAGGCCGGAGGCCGGAGTCCGGG + Intronic
1200062570 X:153490102-153490124 GAGGCCAGAGGCCAGAGCCCAGG - Intronic
1200128969 X:153830809-153830831 GCCGGGCGAGGCGGGAGCGCGGG - Intergenic