ID: 913300890

View in Genome Browser
Species Human (GRCh38)
Location 1:117367456-117367478
Sequence TGCGGTAGCAACAGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 217}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913300881_913300890 11 Left 913300881 1:117367422-117367444 CCGGAGGAGGAAGTTCCGCTCCC 0: 1
1: 0
2: 1
3: 7
4: 107
Right 913300890 1:117367456-117367478 TGCGGTAGCAACAGCGGCGGCGG 0: 1
1: 0
2: 3
3: 24
4: 217
913300885_913300890 -10 Left 913300885 1:117367443-117367465 CCTGACAGACCCGTGCGGTAGCA 0: 1
1: 0
2: 1
3: 2
4: 28
Right 913300890 1:117367456-117367478 TGCGGTAGCAACAGCGGCGGCGG 0: 1
1: 0
2: 3
3: 24
4: 217
913300884_913300890 -9 Left 913300884 1:117367442-117367464 CCCTGACAGACCCGTGCGGTAGC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 913300890 1:117367456-117367478 TGCGGTAGCAACAGCGGCGGCGG 0: 1
1: 0
2: 3
3: 24
4: 217
913300882_913300890 -4 Left 913300882 1:117367437-117367459 CCGCTCCCTGACAGACCCGTGCG 0: 1
1: 0
2: 2
3: 11
4: 274
Right 913300890 1:117367456-117367478 TGCGGTAGCAACAGCGGCGGCGG 0: 1
1: 0
2: 3
3: 24
4: 217
913300880_913300890 14 Left 913300880 1:117367419-117367441 CCGCCGGAGGAGGAAGTTCCGCT 0: 1
1: 0
2: 1
3: 5
4: 70
Right 913300890 1:117367456-117367478 TGCGGTAGCAACAGCGGCGGCGG 0: 1
1: 0
2: 3
3: 24
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913300890 Original CRISPR TGCGGTAGCAACAGCGGCGG CGG Exonic
901002280 1:6154768-6154790 CGCGGCAGCAGCGGCGGCGGCGG - Exonic
902585852 1:17438369-17438391 TGCAGTAGCAGCAGCGGCGGCGG - Exonic
903115519 1:21176254-21176276 GGCGGCAGCAGCGGCGGCGGCGG - Exonic
903115520 1:21176257-21176279 GGCGGCGGCAGCAGCGGCGGCGG - Exonic
905104902 1:35558428-35558450 AGCAGCAGCAGCAGCGGCGGCGG - Intronic
905104903 1:35558431-35558453 TGCAGCAGCAGCAGCAGCGGCGG - Intronic
907244851 1:53102281-53102303 TGCTGTAGCCACGGCAGCGGTGG + Intronic
907429963 1:54406045-54406067 AGCGGTAGCGGCGGCGGCGGCGG - Exonic
907490488 1:54806076-54806098 TGCCGTGGCAGCAGCGGAGGCGG + Intronic
908355924 1:63324446-63324468 GGCGGCCGCAGCAGCGGCGGCGG - Exonic
910145733 1:84078113-84078135 ACCGGCAGCAGCAGCGGCGGCGG - Intronic
911114996 1:94237592-94237614 GGCGGTAGCTGCAGGGGCGGTGG - Intronic
912515031 1:110211749-110211771 AGCGGCAGCAGCGGCGGCGGGGG + Exonic
913186295 1:116373322-116373344 GGCGGCAGCAACAGCGGCGGCGG + Intronic
913300890 1:117367456-117367478 TGCGGTAGCAACAGCGGCGGCGG + Exonic
915142362 1:153775519-153775541 AGCGGTAGCAACAGCAGCAGGGG - Exonic
915574711 1:156767958-156767980 GGGGGAAGCAACAGCGGCGGGGG - Exonic
916588355 1:166166809-166166831 GGCGGAGGCAGCAGCGGCGGCGG + Intronic
922305602 1:224341216-224341238 TGCAGGAGCAGCAGTGGCGGCGG - Intergenic
1063381749 10:5590134-5590156 GGCGGTAGGAACAGCGGTAGGGG + Intergenic
1064185469 10:13158436-13158458 GGCAGCAGCAGCAGCGGCGGCGG - Intergenic
1064185470 10:13158439-13158461 TGCGGCAGCAGCAGCAGCGGCGG - Intergenic
1064230946 10:13528948-13528970 TGCGGTCGCGGCGGCGGCGGCGG + Intronic
1064665243 10:17644162-17644184 CGCGGCAGCAGCTGCGGCGGCGG - Exonic
1065023152 10:21517112-21517134 GGCGGCGGCAGCAGCGGCGGCGG + Exonic
1065023153 10:21517115-21517137 GGCGGCAGCAGCGGCGGCGGCGG + Exonic
1065712730 10:28533148-28533170 AGCGGCGGCACCAGCGGCGGCGG + Intronic
1065712747 10:28533206-28533228 GGCGGCGGCAGCAGCGGCGGCGG + Intronic
1065712748 10:28533209-28533231 GGCGGCAGCAGCGGCGGCGGCGG + Intronic
1069024181 10:63521795-63521817 TGCGGCTGCGACGGCGGCGGCGG + Intronic
1069424683 10:68279040-68279062 GGCGGCAGCAGCGGCGGCGGGGG + Intergenic
1070570608 10:77637596-77637618 GGCGGCAGCAGCGGCGGCGGCGG - Exonic
1070570609 10:77637599-77637621 GGCGGCGGCAGCAGCGGCGGCGG - Exonic
1071956834 10:90769980-90770002 TGCGGGAGCAGCAGTGGCAGTGG + Intronic
1072733744 10:97865638-97865660 AGCGGCAGCAGCAGCGGCAGTGG + Exonic
1074064925 10:110006009-110006031 AGCAGCAGCAGCAGCGGCGGCGG - Intronic
1074821707 10:117184441-117184463 AGCGGTAGCGGCAGCGGCAGCGG - Intergenic
1075032019 10:119030000-119030022 CGCGGTGGGAACGGCGGCGGCGG + Exonic
1075519698 10:123136241-123136263 CGCGGCAGCGGCAGCGGCGGCGG - Exonic
1077442276 11:2574375-2574397 CGTGGTAGCAACAGGGGCTGGGG + Intronic
1077516693 11:3006594-3006616 GGCGGTAGCAACAGGGGCAGCGG + Intronic
1078474924 11:11622003-11622025 AGCGGCAGCGGCAGCGGCGGCGG + Exonic
1078498255 11:11841984-11842006 TGTGGTAGCGGCGGCGGCGGCGG + Exonic
1078830387 11:14972270-14972292 GGCGGTGGCAGCGGCGGCGGCGG + Exonic
1081673567 11:44955301-44955323 TGGTGTAGCAACAGAGGTGGTGG - Intergenic
1082023371 11:47553098-47553120 GGCGGCAGCGGCAGCGGCGGCGG - Intronic
1082787510 11:57324894-57324916 GGCGGTAGCAGCGGCGGCGGCGG - Intronic
1083741450 11:64713644-64713666 AGCAGCAGCAACAGCAGCGGCGG + Exonic
1084284174 11:68120978-68121000 AGCGGCAGCGGCAGCGGCGGCGG + Exonic
1084385749 11:68841792-68841814 TGCGGCAGCGGCAGCGGCAGCGG + Exonic
1084385751 11:68841798-68841820 AGCGGCAGCGGCAGCGGCGGCGG + Exonic
1085205826 11:74731354-74731376 GGCGGTCCCAGCAGCGGCGGCGG + Intronic
1086887914 11:92225355-92225377 AGCGGTAGCAACGGCGGCTCGGG - Intergenic
1089046328 11:115504337-115504359 TGCGGCGGCAGCGGCGGCGGCGG - Exonic
1090125145 11:124076437-124076459 TGCGGGAGCGGCAGTGGCGGTGG - Intergenic
1091764100 12:3107097-3107119 TGCGGTGGCAGCAGTGGTGGTGG - Intronic
1093958788 12:25250889-25250911 GGCGGAGGCAGCAGCGGCGGCGG - Intronic
1096774403 12:53955365-53955387 GGCGGTGGCGACGGCGGCGGCGG + Exonic
1097232829 12:57522749-57522771 TGCGGCAGCGACGGCGGCGGCGG + Exonic
1098541558 12:71663468-71663490 AGCAGCAGCAGCAGCGGCGGCGG - Exonic
1101781830 12:107844537-107844559 CGTGGTGGCAGCAGCGGCGGCGG - Intergenic
1102157503 12:110742807-110742829 GGCGGTGGCAGCAGCCGCGGCGG + Exonic
1102310733 12:111842522-111842544 GGCGGCAGCAGCAGCGGCGGAGG - Intronic
1102853925 12:116277402-116277424 AGCGGCAGCAGCGGCGGCGGCGG - Intergenic
1103563397 12:121804068-121804090 AGCAGCAGCAGCAGCGGCGGCGG + Intergenic
1104805231 12:131585798-131585820 TGCGGGAGCAACAGTAGCGGTGG + Intergenic
1105943555 13:25171225-25171247 GGCGGGGGCGACAGCGGCGGGGG - Exonic
1106665484 13:31846861-31846883 GGCGGTGGCAACTACGGCGGCGG + Intergenic
1107133473 13:36920175-36920197 AGCGGCTGCAGCAGCGGCGGCGG + Exonic
1107146823 13:37069510-37069532 TGTGGGAGCAGCAGTGGCGGTGG + Intergenic
1107851785 13:44577901-44577923 AGCGGCAGCAGCCGCGGCGGCGG - Intergenic
1110630210 13:77698241-77698263 AGCGGTAGTGGCAGCGGCGGTGG + Intronic
1110705869 13:78601972-78601994 CGCGGCAGCGGCAGCGGCGGCGG - Exonic
1111396301 13:87672624-87672646 CGCGGTCGCCACCGCGGCGGCGG + Exonic
1112344254 13:98577026-98577048 AGCGGCAGCAGCGGCGGCGGCGG - Intronic
1113200986 13:107867315-107867337 TGCGGCAGCGGCGGCGGCGGCGG - Intergenic
1113967341 13:114161481-114161503 CGCGGCGGCCACAGCGGCGGGGG + Intergenic
1114405468 14:22452302-22452324 TATGGTAACAACAGCGGCAGTGG + Intergenic
1117690261 14:58298884-58298906 GGCGGCTGCAACTGCGGCGGCGG - Intronic
1119633077 14:76250986-76251008 TGGGGTTGCAACAGGGGCAGAGG + Intronic
1122444994 14:101761704-101761726 TGCGGCAGCCACGGCGGCGGCGG - Intergenic
1123684346 15:22786671-22786693 TGCGGCAGCGGCGGCGGCGGCGG + Exonic
1124353163 15:28974336-28974358 TGCGGAAACCACAGGGGCGGTGG + Intronic
1124957177 15:34367165-34367187 TGCTGCTGCAGCAGCGGCGGCGG + Exonic
1124957178 15:34367168-34367190 TGCTGCAGCAGCGGCGGCGGCGG + Exonic
1128736660 15:70057495-70057517 AGCGGCTGCAGCAGCGGCGGCGG + Exonic
1129058391 15:72838874-72838896 TGCGGTAGTAACTGGGGAGGTGG - Intergenic
1129299240 15:74615918-74615940 CGCGGCGGCGACAGCGGCGGCGG + Intronic
1136230024 16:28880416-28880438 GGCGGTGGCAACAGCTGGGGCGG + Intronic
1136500872 16:30669203-30669225 GGCGGCAGCAGCAGCGGCAGCGG - Exonic
1136500874 16:30669221-30669243 TGCGGCGGCGGCAGCGGCGGCGG - Exonic
1136768474 16:32811550-32811572 AGCGGCGGCAACAGCGGCGGCGG + Intergenic
1136867788 16:33770578-33770600 GGCGGCGGCAAAAGCGGCGGCGG - Intergenic
1137668618 16:50266492-50266514 AGCGGCAGCAGCGGCGGCGGCGG - Intronic
1137786515 16:51141737-51141759 AGCAGCAGCAGCAGCGGCGGCGG - Exonic
1139433907 16:66925492-66925514 GGCTGCAGCAGCAGCGGCGGCGG - Exonic
1139583128 16:67884918-67884940 GCCGGCAGCAGCAGCGGCGGCGG - Exonic
1141147408 16:81541163-81541185 TGGGGTAGGAACAGGGTCGGGGG - Intronic
1203070871 16_KI270728v1_random:1073604-1073626 AGCGGCGGCAACAGCGGCGGCGG + Intergenic
1203104380 16_KI270728v1_random:1345673-1345695 GGCGGCGGCAAAAGCGGCGGCGG + Intergenic
1203129134 16_KI270728v1_random:1616695-1616717 GGCGGCGGCAAAAGCGGCGGCGG - Intergenic
1143063344 17:4222169-4222191 AGGGGTAGCAGCAGCGGCGGCGG - Intronic
1145144256 17:20467473-20467495 AGCGGTGGCCACAGAGGCGGTGG - Exonic
1145175707 17:20698873-20698895 AGCGGTGGCCACAGAGGCGGTGG - Intergenic
1145750016 17:27349085-27349107 TGCTGGAGCAGCAGTGGCGGCGG + Intergenic
1145791608 17:27631239-27631261 AGCGGTGGCCACAGAGGCGGCGG + Exonic
1146896587 17:36545647-36545669 GGCGGCAGAAACAGCAGCGGCGG + Exonic
1147954261 17:44123535-44123557 GGCGGCGGCAGCAGCGGCGGCGG + Exonic
1148603051 17:48908588-48908610 GGCGTTAGCGGCAGCGGCGGCGG + Exonic
1149759993 17:59220534-59220556 GGCAGTAGCAACGACGGCGGCGG - Exonic
1155054459 18:22171669-22171691 GGCGGCAGCAGCCGCGGCGGCGG + Exonic
1155078535 18:22384788-22384810 TGCAGTAGTAGCAGCGGTGGCGG + Intergenic
1158643142 18:59220158-59220180 AGCAGTAGCACCAGCGGCTGCGG + Exonic
1158976508 18:62715767-62715789 TGCGGCAGCAGCAGCAGCAGCGG + Exonic
1161473337 19:4472287-4472309 GGCGGTAGCGGCTGCGGCGGCGG - Exonic
1162176139 19:8832019-8832041 TGAGGAGGCAACAGCGGCGCGGG + Intronic
1162315558 19:9936326-9936348 AGCAGCAGCAGCAGCGGCGGCGG + Exonic
1162470897 19:10871577-10871599 GGCGGTAGCGGCAGCGGCGGCGG + Exonic
1162752688 19:12838522-12838544 TGCGGCAGCAGCGGCGGAGGCGG - Exonic
1163668235 19:18612980-18613002 AGCAGCAGCAGCAGCGGCGGTGG - Exonic
1166043916 19:40218397-40218419 TGCGGTAGCTGCAGCGGCGGCGG - Exonic
926541044 2:14182337-14182359 TGCGGGAGCAGCAGTGGCAGTGG + Intergenic
928409376 2:31042745-31042767 GGTGGTAGCAGCAGCGGAGGTGG - Intronic
930728739 2:54708632-54708654 TGCAGGAGCAGCAGTGGCGGTGG + Intergenic
931300295 2:60973009-60973031 TGTGGGAGCAGCAGTGGCGGCGG + Intronic
931602597 2:64019231-64019253 GGCGGTGGCAGCAGCGGCGGAGG - Intergenic
931728039 2:65129938-65129960 TGCGGCAGCAAGGGCGGCGGTGG - Exonic
934736302 2:96691531-96691553 TGCGGCGCCAGCAGCGGCGGCGG - Intergenic
941686848 2:168456326-168456348 GGCGGGAGCAGCGGCGGCGGCGG + Exonic
941951522 2:171160960-171160982 TCCGGTAGCGGCGGCGGCGGCGG + Intronic
942799688 2:179861255-179861277 GGCGGTAGCAGCGGCGGCGGTGG + Exonic
943185217 2:184598568-184598590 CGCGGCAGCAGAAGCGGCGGCGG - Exonic
946019844 2:216633560-216633582 AGCGGCAGCAGCGGCGGCGGCGG - Exonic
946322290 2:218960997-218961019 AGCGGCGGTAACAGCGGCGGTGG - Exonic
946325337 2:218981931-218981953 GGCGGCAGCAGCTGCGGCGGCGG + Exonic
946395429 2:219441861-219441883 GGCGGCAGCAGCGGCGGCGGCGG - Intronic
946395430 2:219441864-219441886 GGCGGCGGCAGCAGCGGCGGCGG - Intronic
1170629730 20:18056805-18056827 GGCGGCAGCAGCAGCGGCAGCGG - Exonic
1170999353 20:21397135-21397157 GGCGGCAGCAGCTGCGGCGGCGG - Exonic
1172684893 20:36746070-36746092 TGCAGCAGCAGCGGCGGCGGCGG + Exonic
1173681548 20:44885763-44885785 TGCAGTGGCTGCAGCGGCGGCGG - Exonic
1173800464 20:45891584-45891606 AGCAGCAGGAACAGCGGCGGCGG - Exonic
1174053922 20:47785462-47785484 TGCAGCAGCGGCAGCGGCGGCGG - Intronic
1175036295 20:56004282-56004304 TGCAGGAGCGACGGCGGCGGCGG + Exonic
1176380745 21:6111149-6111171 GGAGGCAGCAGCAGCGGCGGCGG + Exonic
1178457780 21:32771562-32771584 GGCGGCGGCAACAACGGCGGCGG + Exonic
1178992418 21:37366876-37366898 GGCGGCGGCAACCGCGGCGGGGG + Intronic
1179742727 21:43427091-43427113 GGAGGCAGCAGCAGCGGCGGCGG - Exonic
1182137457 22:27919228-27919250 GGCGGTAGCGGCGGCGGCGGCGG - Exonic
1183702323 22:39457510-39457532 GGCGGCAGCAGCGGCGGCGGCGG - Exonic
1183893786 22:40951429-40951451 AGCGGCACCAACAGCGGCGCGGG + Exonic
1184465897 22:44668770-44668792 CGCGGTGGCAGCGGCGGCGGCGG + Intronic
950829364 3:15859439-15859461 GGCGGCAGCGGCAGCGGCGGAGG - Exonic
951907805 3:27721618-27721640 GGCGGTAGCAGCGGCGGGGGCGG - Exonic
953863786 3:46566214-46566236 TGCGGTGTAAACAGCCGCGGCGG - Exonic
954351457 3:50047623-50047645 GGTGGGAGCAACAGCGGCGGCGG - Intronic
957792489 3:84959068-84959090 GGCGGTAGCAGCGGCAGCGGCGG - Intronic
959539392 3:107523206-107523228 CGCGGCAGGAGCAGCGGCGGCGG + Intronic
960333509 3:116391255-116391277 TGCGGGAGCAGCAGTGGCGGTGG + Intronic
961960911 3:130854314-130854336 TGTGGTAGTAACAGTGGTGGTGG + Intronic
962301859 3:134250557-134250579 AGCAGAAGCAGCAGCGGCGGCGG + Exonic
966787942 3:183636877-183636899 TCAGGCAGCAGCAGCGGCGGCGG - Intronic
966911431 3:184562296-184562318 AGCGGCAGCAGCAGCAGCGGAGG - Exonic
967272906 3:187745368-187745390 GGCAGTAGCAGCAGCAGCGGCGG + Intronic
968698100 4:2042394-2042416 AGCAGCAGCAGCAGCGGCGGCGG - Exonic
970637114 4:18021698-18021720 GGCGGCGGCAGCAGCGGCGGCGG + Exonic
971629153 4:28967031-28967053 TGCATTAGAAACAGCGGCAGGGG - Intergenic
973759121 4:54100791-54100813 GGCGGCAGCAGCAGCAGCGGCGG + Exonic
973759122 4:54100794-54100816 GGCAGCAGCAGCAGCGGCGGCGG + Exonic
974260509 4:59518877-59518899 TGCAGGAGCAACAGCGGTAGTGG - Intergenic
974586599 4:63887547-63887569 TGATCTAGCAACAGTGGCGGGGG - Intergenic
974854666 4:67446079-67446101 GGCGGTAGCGGTAGCGGCGGCGG - Intergenic
975986020 4:80202315-80202337 AGCGGTAGCGGCAGCGGCGGCGG + Exonic
976281977 4:83334733-83334755 AGCAGCAGCATCAGCGGCGGCGG + Exonic
976390040 4:84497794-84497816 CGCGGCAGCAGCCGCGGCGGCGG + Exonic
977810025 4:101347341-101347363 GGCAGCAGCAACAGCGGCAGCGG - Exonic
979582780 4:122379585-122379607 GGTGGGAGCAACGGCGGCGGCGG + Intronic
981615454 4:146639363-146639385 AGCAGTGGCAGCAGCGGCGGCGG + Exonic
981782590 4:148444581-148444603 GGCGGCGGCAGCAGCGGCGGCGG - Intronic
983563198 4:169122174-169122196 AGCAGCAGCAGCAGCGGCGGTGG + Exonic
988495559 5:31742554-31742576 TGGGGTAGAAACAGTGGTGGGGG - Intronic
990825592 5:59894005-59894027 AGCAGCAGCAACGGCGGCGGCGG + Intronic
990955032 5:61332342-61332364 GGCGGGGGCAGCAGCGGCGGCGG + Exonic
992690424 5:79236212-79236234 TGCAGCAGCACCAGGGGCGGGGG + Exonic
995650535 5:114362939-114362961 TGAGGACGAAACAGCGGCGGCGG - Exonic
1001524986 5:172422498-172422520 TGCGGGAGCAACAGAGGAGATGG + Intronic
1002204726 5:177554516-177554538 AGCGGTAGCGGCGGCGGCGGCGG - Intronic
1002415815 5:179120553-179120575 TGCGGTGTGAACAGAGGCGGTGG + Intronic
1005740469 6:28786149-28786171 TGCGGCAGCAAAGGCGGAGGAGG + Intergenic
1006077293 6:31541971-31541993 GGCGGCAGCAACAGCGACGAAGG + Exonic
1006136224 6:31897644-31897666 GGCGGGAGCTGCAGCGGCGGCGG - Exonic
1006458271 6:34144181-34144203 TGGGGCAGCAGCATCGGCGGCGG - Intronic
1009975631 6:70667979-70668001 TGGGGCAGCTACGGCGGCGGCGG - Exonic
1012170940 6:96016070-96016092 CGAGGCAGCGACAGCGGCGGGGG - Exonic
1012490641 6:99779747-99779769 TGTGTTAGCAGCAGCGGCAGTGG + Intergenic
1013575798 6:111482932-111482954 AGCGGCAGCAGCAGCGGCGGCGG + Exonic
1013793032 6:113857630-113857652 GGCGGCGGCAACAGCGGCAGCGG - Exonic
1013793034 6:113857645-113857667 AGCAGCAGCAGCAGCGGCGGCGG - Exonic
1016034543 6:139373361-139373383 GGCAGCAGCAACAGCGGCGGCGG - Exonic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1017103151 6:150865910-150865932 CGCGCTAGCAGCGGCGGCGGCGG + Exonic
1018400328 6:163414602-163414624 GGCGGCAGCAGCGGCGGCGGCGG - Intronic
1018400329 6:163414605-163414627 GGCGGCGGCAGCAGCGGCGGCGG - Intronic
1019474148 7:1236078-1236100 TCCGACAGCGACAGCGGCGGCGG + Exonic
1020832288 7:13107955-13107977 TGAGGAAGCAACAGCAGAGGTGG + Intergenic
1020897885 7:13965041-13965063 AGTAGTAGCAGCAGCGGCGGAGG - Intronic
1021313142 7:19117029-19117051 GGCGGCAGCAGCAGCGGCGGCGG - Exonic
1023038391 7:36152829-36152851 TGGGGTAGGAAAAGCGGGGGCGG - Intergenic
1024965161 7:55018191-55018213 TGCGGGAGCTACAGGGGCAGTGG + Intergenic
1029640411 7:101816426-101816448 CGCGGCGGCAACGGCGGCGGCGG - Intronic
1029926918 7:104328478-104328500 TGCAGCAGCTGCAGCGGCGGCGG + Intergenic
1030111618 7:106031566-106031588 AGCAGCAGCAGCAGCGGCGGCGG - Intronic
1030739070 7:113086584-113086606 TGCGGTGGCGAGGGCGGCGGCGG + Intronic
1032461837 7:132117737-132117759 TGCTGTGGCAACAGCTGGGGTGG - Intergenic
1034469725 7:151248764-151248786 TGCGGCAGCCGCGGCGGCGGCGG - Exonic
1037428382 8:18782729-18782751 TGCGGCTGCAACAGCAGCAGAGG + Intronic
1038055599 8:23854743-23854765 AGCAGCAGCAGCAGCGGCGGTGG - Exonic
1039453945 8:37696025-37696047 AGCGGCAGCGGCAGCGGCGGCGG + Exonic
1041910731 8:63086024-63086046 TGCGGCCGCAGCAGCGGCGGCGG - Exonic
1042040227 8:64581418-64581440 AGCGGTAGCAGTGGCGGCGGTGG + Exonic
1047024558 8:120811819-120811841 GGCGGTAGCGGCGGCGGCGGCGG - Exonic
1049657338 8:143804661-143804683 GGTGGTGGCAACAGCAGCGGTGG + Exonic
1050455835 9:5833086-5833108 TGCGGCAGCGACGGCGGCGTCGG - Exonic
1052643505 9:31200701-31200723 TGGGGTATCAACAGAGGCTGAGG + Intergenic
1054738475 9:68780231-68780253 GGCGGTGGCAGCGGCGGCGGCGG + Exonic
1055770201 9:79708746-79708768 GGCAGCAGCAGCAGCGGCGGCGG - Exonic
1060634560 9:125189732-125189754 AGCCGCGGCAACAGCGGCGGCGG + Exonic
1061084785 9:128392601-128392623 TCCGGGCGCAACAGGGGCGGGGG - Intergenic
1061236218 9:129344113-129344135 AGAGGTTGCAACATCGGCGGAGG + Intergenic
1187205132 X:17174797-17174819 AGCAGCAGCAGCAGCGGCGGCGG - Intergenic
1187547323 X:20266768-20266790 AGCAGCAGCAGCAGCGGCGGCGG + Exonic
1187932956 X:24311040-24311062 TGCAGCAGCAGCAGCGGCTGTGG + Intergenic
1188005539 X:25013676-25013698 TGCGGCAGCGGCGGCGGCGGCGG - Exonic
1189418454 X:40834529-40834551 AGCAGGAGCAGCAGCGGCGGAGG + Intergenic
1189731862 X:44029236-44029258 AACAGTAGCAACAGCAGCGGCGG + Intergenic
1189794349 X:44633344-44633366 CGCGGCAGCAGCGGCGGCGGTGG + Intergenic
1190573952 X:51814272-51814294 GGCGGTAGCAGCAGCGGCAGCGG - Intronic
1192361650 X:70444748-70444770 AGCGGCAGCGGCAGCGGCGGCGG - Intergenic
1192925015 X:75747136-75747158 AGCGGCAGCAGCGGCGGCGGCGG - Intergenic
1193312254 X:80023104-80023126 TGCGGCAGCGACAGCGGCTACGG + Exonic
1194808661 X:98363106-98363128 TGGGGTAGTAGTAGCGGCGGTGG + Intergenic
1197754458 X:129984183-129984205 AGCAGGAGCAGCAGCGGCGGCGG - Intronic
1198807223 X:140504329-140504351 TGCGGCCGCGGCAGCGGCGGCGG + Exonic
1200229540 X:154437167-154437189 TGCGGTGGCGGCGGCGGCGGTGG + Exonic
1200231070 X:154444158-154444180 AGCGGCAGCGGCAGCGGCGGTGG - Exonic