ID: 913303766

View in Genome Browser
Species Human (GRCh38)
Location 1:117401331-117401353
Sequence CAGAGCTTGAATTAAATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 343}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913303764_913303766 21 Left 913303764 1:117401287-117401309 CCATTTTACATTCTCACTAGCAA 0: 11
1: 149
2: 838
3: 2426
4: 4298
Right 913303766 1:117401331-117401353 CAGAGCTTGAATTAAATTTCTGG 0: 1
1: 0
2: 1
3: 22
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913303766 Original CRISPR CAGAGCTTGAATTAAATTTC TGG Intronic
901243958 1:7713734-7713756 AAGATCTTGTATTCAATTTCAGG - Intronic
902047637 1:13537843-13537865 CAGAGCTGGAATTCAAACTCAGG + Intergenic
904366759 1:30016034-30016056 CAGAGCTAGAATTAAATCTTGGG - Intergenic
904913448 1:33952499-33952521 CTGAGGTTGGATTAAATGTCAGG - Intronic
904913456 1:33952566-33952588 CTGAGGTTGGATTAAATGTCAGG - Intronic
906754713 1:48299567-48299589 CTGAGCTGGAATTCAGTTTCAGG - Intronic
907364672 1:53947936-53947958 CAGAGCCAGAATTCAATCTCAGG - Intronic
907481838 1:54750379-54750401 AAGAGCCTGAATTCAAGTTCTGG - Intergenic
907569880 1:55473365-55473387 CAGAGCTGGAATTCAAACTCAGG - Intergenic
907622009 1:55991157-55991179 CAGAGCTGGAATTCCAATTCAGG - Intergenic
909245240 1:73272833-73272855 CAGAGCCTGAAATACATGTCGGG - Intergenic
909928626 1:81469062-81469084 CAGAGCATGCTTTAAATTTTTGG - Intronic
912033355 1:105277951-105277973 CAATGCTTGACTTAAATTTTAGG - Intergenic
912478884 1:109962376-109962398 CAGAGCTAGGATTTAATCTCAGG + Intergenic
912560340 1:110547119-110547141 CATAGCTGGAATTTAATTCCAGG + Intergenic
912678466 1:111709681-111709703 CAGAGTTTTAATTTAATTTGGGG - Intronic
912957736 1:114167330-114167352 CAGAGCTTGTGGTAAATGTCAGG - Intergenic
913067304 1:115268090-115268112 CGAAGGTTGAATTAAATTTTAGG - Intergenic
913303766 1:117401331-117401353 CAGAGCTTGAATTAAATTTCTGG + Intronic
915033123 1:152901236-152901258 CATACCTTGATTTATATTTCAGG + Intergenic
915803506 1:158819385-158819407 CAGAGCCTGGATTAAAAGTCAGG - Intergenic
916438197 1:164796364-164796386 TAGAGCTTGGAATAAAATTCAGG - Intronic
916746926 1:167691777-167691799 CTCAGTTTGAATTAAATTTCAGG - Intronic
916920799 1:169464134-169464156 CAAACTTTGAATTAAATTCCAGG + Exonic
917162223 1:172070646-172070668 CAGAGCTGAAATTCAAATTCAGG - Intronic
917402415 1:174665224-174665246 CAGAGCTAGAATTCAAACTCTGG - Intronic
917473766 1:175350485-175350507 TAGACCTTGGATGAAATTTCAGG + Intronic
918166232 1:181950459-181950481 CACAGCTGTAATTAAAATTCTGG - Intergenic
918185264 1:182121175-182121197 CAGAGATTGACTTAAAGTTACGG + Intergenic
919087683 1:192940684-192940706 CAGAACCTGAATTTTATTTCTGG - Intergenic
919531460 1:198726551-198726573 CAGAGCCTGAATTCAAGCTCAGG + Intronic
919832759 1:201553384-201553406 CAGAGCTTGAGCCAGATTTCAGG + Intergenic
919893270 1:201991647-201991669 CAAAACTGGAATTAAAATTCAGG + Intronic
920032330 1:203044873-203044895 AACTGCTTGAATTAAATTTGAGG + Intronic
920680054 1:208065344-208065366 CAGAGCTGGTATTTAAATTCAGG - Intronic
921110213 1:212028901-212028923 CAGAGCTGGGATTCAAATTCTGG + Intronic
922401712 1:225265701-225265723 AAGAGTTTCAATTCAATTTCAGG + Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1063842872 10:10091707-10091729 ATGATCTTGAATTAAATCTCTGG + Intergenic
1063986040 10:11503511-11503533 CAGAGCTAAAATTAAAAATCAGG + Intronic
1064077607 10:12282229-12282251 CAGAGCTTGCATTGGATCTCAGG + Intergenic
1065392413 10:25196731-25196753 CAGAGATTGAAAGACATTTCTGG - Intronic
1066382897 10:34916831-34916853 CAGAGCTTGGAGTTAATGTCAGG + Intergenic
1066708891 10:38211818-38211840 CAGGGCTAGAATTAGATTGCTGG - Intergenic
1066980607 10:42410671-42410693 CAGGGCTAGAATTAGATTGCTGG + Intergenic
1067113564 10:43417962-43417984 CAGAGATTTAATAAAATTTGTGG + Intergenic
1067465005 10:46491219-46491241 CAGAGCTGGAATTTAAATCCAGG - Intergenic
1067622183 10:47893382-47893404 CAGAGCTGGAATTTAAATCCAGG + Intergenic
1067894482 10:50164166-50164188 CAGTGCTAGAATTAAAATCCAGG - Intergenic
1068396073 10:56463976-56463998 CAGAACTGGAATTAAAATTCAGG - Intergenic
1068555561 10:58454908-58454930 CACAGCTTGAATTTAAATCCAGG + Intergenic
1072459221 10:95604317-95604339 CAGAGCTGGAAAAAAAATTCTGG + Intergenic
1074981271 10:118621692-118621714 CACAGTTTGAAGTAAATTCCAGG - Intergenic
1077651436 11:3976575-3976597 CTGAGCTTGAATTACGTGTCAGG - Intronic
1078493787 11:11795875-11795897 CAGAGCTAGGATTCAAATTCAGG + Intergenic
1079546022 11:21632730-21632752 AAGACCTTGAATTAAATGTAAGG + Intergenic
1081838962 11:46181804-46181826 CAGAGTTAGGATTAAATCTCAGG + Intergenic
1081885609 11:46493320-46493342 CATAGCTAGAATTTAATTGCTGG + Intronic
1084773305 11:71357995-71358017 CAGAGCTGGAATTTAACCTCAGG - Intergenic
1086189480 11:84061498-84061520 CAGAGATTGGATTTGATTTCAGG + Intronic
1086382161 11:86266895-86266917 AAGAGCTAGAATTCATTTTCTGG + Intronic
1086795742 11:91099922-91099944 AAAAGCTTGAAATAAATATCAGG - Intergenic
1086878226 11:92123786-92123808 CAGAGCTTGTAGGAAATGTCTGG + Intergenic
1087094057 11:94303617-94303639 CAGAGCTGGGATATAATTTCAGG - Intergenic
1088700782 11:112409410-112409432 CAGAGCTGGAATTCAATACCAGG + Intergenic
1091431819 12:442416-442438 CAGAGCCTGAATTACGTTTTTGG + Exonic
1091950383 12:4587945-4587967 TAGAGCTTGAATCGAAGTTCTGG - Intronic
1093724965 12:22494599-22494621 CAGTTCTTGAATTAAAGTTTTGG + Intronic
1094554859 12:31488753-31488775 CAAATCTTGATTTATATTTCAGG - Intronic
1096070099 12:48770456-48770478 CAGAGCTGGGATTAAAAATCAGG - Intronic
1096205784 12:49720430-49720452 CAGAGCTTGAATTTGAGCTCTGG - Intronic
1097802812 12:63933752-63933774 CAGAGCTTGAATCTAATGTGAGG + Intronic
1098367171 12:69716534-69716556 CAAAGCTGGGATTAAAATTCAGG + Intergenic
1099417753 12:82414074-82414096 CTCGGCTTGAATTAAGTTTCTGG + Intronic
1099418970 12:82428698-82428720 CAGAGCTGGAATTTAAACTCAGG - Intronic
1100369657 12:93956220-93956242 CAGAGCTGGAATTAAAACCCAGG - Intergenic
1100426372 12:94490820-94490842 CAGTGCTGGAATTACATTCCAGG + Intergenic
1100764898 12:97853239-97853261 CAGAGCTGGAACTAGAATTCAGG - Intergenic
1101665002 12:106804774-106804796 CTGACCTTGAATTATATTTATGG - Intronic
1102289533 12:111687797-111687819 CAGAGCTGGAACTGAAATTCAGG + Intronic
1104232003 12:126894370-126894392 CAGATTTTTAATAAAATTTCTGG - Intergenic
1104260893 12:127181147-127181169 CAGAGCTTGAGTTTAAATCCAGG + Intergenic
1105276918 13:18938690-18938712 GTGAAATTGAATTAAATTTCAGG - Intergenic
1105571527 13:21607558-21607580 CAGAGGTTGAACTATATTTATGG + Intergenic
1107166302 13:37284713-37284735 CAGAGCATTACTTAATTTTCTGG - Intergenic
1107828711 13:44354445-44354467 CAGACCTGGACTTAAATTCCAGG + Intergenic
1108008559 13:45978442-45978464 CAGAGCTGGAATTCAAACTCAGG - Intronic
1109556070 13:63976950-63976972 GAGAGGTAGAAATAAATTTCTGG + Intergenic
1109995726 13:70122881-70122903 TAGAGCTGGAATTAAAATCCAGG - Intergenic
1110163235 13:72404933-72404955 CAGAGCTTTAATTCCATTTTAGG + Intergenic
1110321850 13:74169425-74169447 CAGAGCTAGAATTAAAATCCAGG + Intergenic
1111421238 13:88014019-88014041 GAGAGCTGGAATCAAATTTATGG + Intergenic
1111862134 13:93721087-93721109 CAGAACTTGAATTCAAGCTCTGG - Intronic
1112395682 13:99028667-99028689 CAGAACTTTAATTAAATTTAAGG + Intronic
1112508021 13:99986973-99986995 CTGAGAGTGAATTAAATTTTTGG + Intergenic
1112523677 13:100121962-100121984 CAGAGCCTAAATCAAATTTAAGG - Intronic
1113075294 13:106461947-106461969 CAGAGCTGGAATCATATTTTAGG + Intergenic
1113287982 13:108874589-108874611 CAGAGCTAGCATTAAAGTCCAGG + Intronic
1114073926 14:19141134-19141156 AAGAGCTTCAAATAAATTTAAGG - Intergenic
1114088340 14:19258838-19258860 AAGAGCTTCAAATAAATTTAAGG + Intergenic
1115030069 14:28784546-28784568 CAGAGTTTCTATTACATTTCTGG + Intronic
1115093500 14:29606916-29606938 CAGAGCTGGAATTCAAACTCAGG - Intronic
1115966294 14:38892433-38892455 GAGAGCTTGAATTACATTATAGG + Intergenic
1116639335 14:47440884-47440906 CAGAGGTAGAATTAAATTCAAGG + Intronic
1117706124 14:58470012-58470034 CAGATATTGGATTAACTTTCTGG - Intronic
1118949107 14:70417978-70418000 CTGAACTTGAATGAAACTTCAGG + Intergenic
1120013420 14:79443573-79443595 CAAAGATTGAACTAAAATTCTGG + Intronic
1121224747 14:92313074-92313096 AAGACCTTGAATATAATTTCTGG - Intergenic
1121422968 14:93828576-93828598 CAGAGCTGGAATGAGATTCCAGG + Intergenic
1122565511 14:102652282-102652304 CAGAGCTGGGATTCCATTTCAGG + Intronic
1125041266 15:35190058-35190080 CAGTGCTGGAATAAAATTTCAGG + Intergenic
1125041274 15:35190113-35190135 CAGTACTGGAATAAAATTTCAGG + Intergenic
1125256830 15:37774202-37774224 CAGACCTTCAATTAAATGTTAGG - Intergenic
1125301680 15:38261145-38261167 CAGAGATTAAATGACATTTCTGG - Intronic
1126522937 15:49617581-49617603 CAGAGCATCAATTAAATGTGTGG + Intronic
1126525000 15:49644021-49644043 CAGAACTAGAATTAGAATTCTGG + Exonic
1126918349 15:53491319-53491341 CAGAACTTGATTTCAACTTCAGG + Intergenic
1127568548 15:60217214-60217236 CAGAGCTGGAATTCAAACTCAGG - Intergenic
1130559691 15:84948178-84948200 ATGAGCTTGAATTAAATTGAGGG - Intergenic
1130738757 15:86575922-86575944 TAGTTCTGGAATTAAATTTCTGG - Intronic
1131790191 15:95956177-95956199 CAGACTTTGAATTCATTTTCTGG + Intergenic
1133191892 16:4139978-4140000 CAGAGCTGGGATTCAATCTCAGG - Intergenic
1133844544 16:9441705-9441727 CAGAGGTGAAATAAAATTTCAGG + Intergenic
1134830601 16:17319769-17319791 CAGAGCTGGAATTCAAATTCAGG - Intronic
1135831137 16:25774527-25774549 CAGAGTCTGAATTAAAGCTCAGG - Intronic
1136176012 16:28517276-28517298 CAGAGCTAGACTTCAATTCCAGG + Intergenic
1138163741 16:54780399-54780421 CTGAGCTTGAAAAAAAATTCAGG + Intergenic
1138766133 16:59607062-59607084 AAAAGCTTGAATTAGAATTCTGG + Intergenic
1138866825 16:60831852-60831874 TAGAGCTAAAATTAAAATTCAGG - Intergenic
1139943077 16:70620109-70620131 CAGGGCTGGAATTTAATTTTTGG + Intronic
1140177018 16:72672179-72672201 CAGAGATTTAATTAAATGTATGG - Intergenic
1142721066 17:1776236-1776258 AGGAGCTAGAATTGAATTTCAGG - Intronic
1143583083 17:7837575-7837597 CAGAGCTAGAATTAGAATCCAGG - Intergenic
1144478460 17:15609528-15609550 CAGAGCTGGAATTTAAACTCAGG - Intronic
1144919831 17:18754183-18754205 CAGAGCTGGAATTTAAACTCAGG + Intronic
1145825774 17:27876222-27876244 CAAAACTTGAATTAAGGTTCAGG - Intronic
1147342006 17:39758151-39758173 CATAGCTTATTTTAAATTTCTGG - Intergenic
1148569470 17:48656699-48656721 CTGACCTTGATTTATATTTCTGG + Intergenic
1148918285 17:51003367-51003389 CAGAGCATGAATTAAAATAATGG - Intronic
1150411522 17:64947105-64947127 AAGAGGCTGAATTAAAATTCTGG + Intergenic
1150789789 17:68194783-68194805 AAGAGGCTGAATTAAAATTCTGG - Intergenic
1150932724 17:69602803-69602825 CAGAGCTGGGATTAGAATTCAGG + Intergenic
1151119222 17:71773533-71773555 CAGAGATTCTCTTAAATTTCAGG - Intergenic
1152040213 17:77898134-77898156 CAGAGCTGGAATTGGATCTCAGG + Intergenic
1152263367 17:79279075-79279097 CAGAGCTGGGACTAAAATTCTGG + Intronic
1153938670 18:9956213-9956235 CAGAGCTGGAACTAGATATCTGG + Intronic
1154010548 18:10570268-10570290 AAGAGATTGATTTAGATTTCTGG + Intergenic
1156330542 18:36117670-36117692 TAGAGCTTGAATGAAATCTTAGG - Intronic
1156372244 18:36482017-36482039 GAGAGCTTGAAATAATTTTCAGG - Intronic
1158512377 18:58102092-58102114 CAGAGCTTAAATAAACATTCAGG - Intronic
1164567956 19:29341924-29341946 CAGAGATTAACTTAAATATCTGG - Intergenic
1166890104 19:45986304-45986326 CAGAGCTGGAATTGAAATCCAGG + Intergenic
926006265 2:9375686-9375708 CAGAGCTGGCATTACATTTTTGG - Intronic
927815499 2:26212854-26212876 CAAAGCTTGAATTACTCTTCCGG + Intronic
929034187 2:37674747-37674769 CAGAGCTTAAATTAAACCTGGGG + Intronic
931150044 2:59562933-59562955 CAGAGCTTGCATTTAATTTGGGG + Intergenic
931798852 2:65739014-65739036 GAGAGCTTGAAGTAAAGTCCTGG + Intergenic
932549710 2:72755555-72755577 TAGAACTTGAATTAACTTTTTGG - Intronic
933026756 2:77269863-77269885 AAGAGCTTGAACTAAACTCCAGG + Intronic
933155340 2:78966850-78966872 GGAAGCTTGTATTAAATTTCTGG + Intergenic
933459564 2:82564331-82564353 CAATGCCTCAATTAAATTTCAGG - Intergenic
935892768 2:107697482-107697504 CAGAGGTTAAATAAACTTTCAGG + Intergenic
936144325 2:109969554-109969576 CAGAGCTTTAATAAAAACTCAGG - Intergenic
936181007 2:110267514-110267536 CAGAGCTTTAATAAAAACTCAGG - Intergenic
936200364 2:110401915-110401937 CAGAGCTTTAATAAAAACTCAGG + Intergenic
936469167 2:112783024-112783046 AAGAGCTTTAATTGAAGTTCAGG + Intronic
936846486 2:116841280-116841302 CAGAACATGAATTACAGTTCTGG + Intergenic
937613844 2:123896281-123896303 CAGAGCTAGATTTTAAATTCAGG + Intergenic
938487838 2:131732134-131732156 AAGAGCTTCAAATAAATTTAAGG - Intronic
938756375 2:134383424-134383446 CAGTGCTTGATTTAAATTGGAGG - Intronic
940473817 2:154134341-154134363 CAGAGGTTGAAGGAACTTTCTGG + Intronic
941732230 2:168931554-168931576 TTGAGATTGAATTAATTTTCAGG + Intronic
941805513 2:169708168-169708190 CAGAGCTAGAATTCAAATTCAGG - Intronic
942015312 2:171807541-171807563 AAGAGCATGACTTATATTTCTGG + Intronic
942506100 2:176643082-176643104 CACACCTTAAATTAAATTTATGG + Intergenic
942600119 2:177632561-177632583 CAGAGCATGAAATAGATTTGAGG - Intronic
943646949 2:190416661-190416683 CAGAGTTTTAATGAAATATCTGG + Intronic
944016039 2:195039270-195039292 CTGAGATTGAATTAAACTCCTGG - Intergenic
944123720 2:196269900-196269922 GACCTCTTGAATTAAATTTCTGG + Intronic
944136195 2:196402325-196402347 CAGACCTTGAGTTTCATTTCTGG + Intronic
944641549 2:201731388-201731410 CAGAGCTAGAATTAATATCCAGG - Intronic
946584314 2:221167243-221167265 CAGAGCTATAATTATATTTCTGG + Intergenic
946734014 2:222736384-222736406 CAGAGCTGGGATTACAGTTCAGG - Intergenic
948503036 2:238408716-238408738 CAGGGTTTGAATAAAATTTTTGG - Intergenic
1169128044 20:3145132-3145154 CAAAGCTTCACTTATATTTCAGG - Intronic
1169707826 20:8526267-8526289 CAGTGCTCAAATAAAATTTCAGG - Intronic
1170948960 20:20917009-20917031 CAGAGATTGCCTTAAATATCTGG - Intergenic
1171411703 20:24952320-24952342 CAGAGCTGGAATTCAAACTCCGG + Intronic
1172501066 20:35427815-35427837 CATAGCTGGAGTTTAATTTCAGG + Intergenic
1174575511 20:51534210-51534232 CAAAGCTTGCATTCAATTTCAGG + Intronic
1176387950 21:6148613-6148635 CAGACCTGGAATTAAACGTCAGG + Intergenic
1177334485 21:19705921-19705943 CAGAGCTTGGTTGAAACTTCAGG + Intergenic
1177396392 21:20540613-20540635 CAGTGCTTGACTAAAATTTGAGG + Intergenic
1178926063 21:36776063-36776085 CAGAACATGATTTGAATTTCTGG - Intronic
1179735522 21:43389635-43389657 CAGACCTGGAATTAAACGTCAGG - Intergenic
1180492372 22:15863492-15863514 AAGAGCTTCAAATAAATTTAAGG - Intergenic
1181959027 22:26609783-26609805 CAAAGCTTGGATTAGAATTCAGG - Intronic
1182110965 22:27723231-27723253 CAGAGCTAGAATTTAAACTCAGG - Intergenic
1183261393 22:36798043-36798065 CAGAGCTGGAATTAAATGCAGGG - Intergenic
1184096087 22:42317324-42317346 GAGAACTTGCAGTAAATTTCTGG - Intronic
949829686 3:8200818-8200840 CAGAGCTGGAAGGAAAGTTCTGG + Intergenic
949937716 3:9129675-9129697 CAGAGCTTAAATTTCATTTGAGG - Intronic
950601856 3:14042054-14042076 CAGAGCTTTAACTACATTACTGG + Intronic
953736807 3:45501410-45501432 CATAGGTAGAATTATATTTCAGG + Intronic
954326495 3:49866955-49866977 CAGAGCTTGCAGTAAATCTAGGG + Intronic
955107415 3:55911657-55911679 CAGAGCATGAATGAGATTTCAGG + Intronic
956133142 3:66073214-66073236 CAGATCTTGGCTTAAATGTCAGG - Intergenic
956310346 3:67871614-67871636 CAGTGCTTCAGTTATATTTCTGG + Intergenic
956660592 3:71593255-71593277 CAGAGCTTGATTCAAAACTCAGG + Intergenic
956744816 3:72302985-72303007 CAGAGCTGGGATTACATTTATGG - Intergenic
957385088 3:79486012-79486034 CAGAACTGGAATTGAAATTCAGG - Intronic
959990626 3:112627546-112627568 CAGAGCTTGATTTATTTTTAAGG + Intronic
960263136 3:115590749-115590771 CAGATCTGGATTTAAAGTTCTGG - Intergenic
962470666 3:135705300-135705322 CAGAGATTGAACTAAGTGTCTGG - Intergenic
963036845 3:141037867-141037889 CAGAGCTGGAATTTAAATACAGG - Intergenic
963572442 3:147015214-147015236 CAGAGGATGATTTAAGTTTCTGG + Intergenic
964385742 3:156145695-156145717 CAGAGCTTGAATTTGAACTCTGG - Intronic
964535705 3:157718635-157718657 CAGAGCTTGAATTTGAATTTGGG + Intergenic
964995705 3:162877564-162877586 CAGATCTTGAATTAAAATTTTGG - Intergenic
965328299 3:167335443-167335465 CTGAGTTTGAATTAAACTCCAGG + Intronic
965624912 3:170676186-170676208 CAGGGCTGGAATTTAATTTTTGG + Intronic
965657021 3:170998211-170998233 CAGAGCTACAATGAAATTGCAGG + Exonic
966563828 3:181353602-181353624 CAGAGTTTGGATGAAGTTTCAGG + Intergenic
967584780 3:191198913-191198935 CAGAGCTTGACTAAAACCTCAGG + Intergenic
967762799 3:193243672-193243694 CACAACTGGAATTCAATTTCAGG - Intronic
972214380 4:36878855-36878877 CAGAGGCTGAAATAACTTTCTGG - Intergenic
973161065 4:47017119-47017141 CAGATCTGGAATTACTTTTCAGG - Intronic
974408027 4:61501095-61501117 CAGAGCTGGAATTTCATCTCTGG - Intronic
974410641 4:61537860-61537882 CATATCCTGAATTATATTTCTGG + Intronic
975085928 4:70339819-70339841 CAGACGTTTAATCAAATTTCAGG - Intergenic
975426291 4:74231657-74231679 CAGAGCTGGAATTTAAATCCTGG - Intronic
977313900 4:95420939-95420961 CAGATCTGGAATTAAATGCCAGG - Intronic
977885422 4:102247677-102247699 CAGAGGTAGAATTTAATGTCTGG + Intergenic
980383270 4:132055025-132055047 CAGAGATAGAGTTAAATTTTTGG - Intergenic
980500346 4:133643363-133643385 CAGTGCTTGAAAGAAAATTCAGG - Intergenic
980859840 4:138486124-138486146 TAGAGCTTGATTCAAAGTTCAGG - Intergenic
981181056 4:141745141-141745163 CACAGCTCGGATAAAATTTCAGG - Intergenic
982169655 4:152648607-152648629 CAGAACTTGACTTGACTTTCAGG - Intronic
982628432 4:157799063-157799085 AAAAGCTTAAAATAAATTTCTGG - Intergenic
983534060 4:168838786-168838808 AAAAGCTTAAATGAAATTTCTGG - Intronic
985134389 4:186770785-186770807 TAGAGCTTGAATTCTATCTCTGG - Intergenic
987768935 5:22274877-22274899 CATTTCTTGAGTTAAATTTCGGG + Intronic
987928877 5:24377224-24377246 CAGAGCTTGCATTAATTTATTGG + Intergenic
988110330 5:26811739-26811761 CAAAGCTTGTATTAAAATTGTGG + Intergenic
988117215 5:26910988-26911010 CAAAGCATGATTTAAATTCCTGG - Intronic
988531849 5:32034660-32034682 CAGAGAGTGAGTTAAATTCCTGG - Intronic
991655014 5:68895306-68895328 CAGAGCTGGGACTAAAATTCAGG + Intergenic
992428076 5:76678915-76678937 GAGAGCTTGATGTAAATGTCAGG - Intronic
993065970 5:83096988-83097010 TAGAGCTTGACTTAAATTTTAGG + Intronic
993260373 5:85650135-85650157 CATATCTTGAATCTAATTTCTGG - Intergenic
993260521 5:85652509-85652531 CATACCTTGAATCTAATTTCTGG - Intergenic
994926145 5:106119837-106119859 CAGAAATTATATTAAATTTCAGG - Intergenic
995068326 5:107888351-107888373 CATAGTTTTAATTAACTTTCTGG + Intronic
995138358 5:108705015-108705037 CAATGCTTGAATTAAAATTGAGG + Intergenic
995247524 5:109951339-109951361 CAGAGCTGGAATTTAAATTCTGG + Intergenic
995652920 5:114391464-114391486 AAAAGCTTGGATTTAATTTCTGG - Intronic
997811789 5:136977864-136977886 CAGACCTGGAACAAAATTTCTGG - Exonic
999126504 5:149250112-149250134 CTGAGCTTGACTTCAATTCCAGG + Intronic
999727578 5:154449148-154449170 AACAGCCTGAATTGAATTTCTGG - Intronic
999882678 5:155883937-155883959 CAGAACTGGGACTAAATTTCAGG + Intronic
1000412661 5:160949824-160949846 GAGATCTTGAATTAAACCTCAGG - Intergenic
1000439691 5:161250531-161250553 GAGAGCTGGAATTTAATTTTTGG - Intergenic
1000470536 5:161634677-161634699 ATGAGCTTGAATTAATTTGCTGG + Intronic
1000624411 5:163522894-163522916 CGGAGCTTGAAGTAATTTTTAGG + Intergenic
1001020548 5:168178846-168178868 CAGTGCTGGAATTAAAGTGCTGG - Intronic
1001245122 5:170100487-170100509 CAGGGCTTGGGTGAAATTTCAGG - Intergenic
1001724552 5:173886169-173886191 CAGAGCTGGGATTCAAATTCAGG + Intergenic
1004567413 6:16811739-16811761 CAGAGTTTGAGTTTAATGTCTGG - Intergenic
1005677364 6:28168746-28168768 CCTAACATGAATTAAATTTCAGG - Intergenic
1007236730 6:40395785-40395807 CAGAGCTGGGATTAAATCCCAGG + Intronic
1008602257 6:53107668-53107690 CAGAGCCTGAGTTAAAGTGCAGG + Intergenic
1009395236 6:63192354-63192376 CAGAGCTTAAAATAATTTTACGG - Intergenic
1009577091 6:65479285-65479307 AAGAGGCTGAATTAAAGTTCTGG + Intronic
1010154558 6:72777764-72777786 CAGAGCCTGCCCTAAATTTCAGG + Intronic
1010777039 6:79899153-79899175 CAGAGCTTGAACTAGAATCCAGG - Intergenic
1010787826 6:80025480-80025502 CAGAGGTTCACTTCAATTTCAGG - Intronic
1012354658 6:98298948-98298970 CAGAACTTGAATTAGAATACCGG + Intergenic
1014206967 6:118666399-118666421 CAGAGCCTGAATTAAAAGCCTGG + Intronic
1014848286 6:126307398-126307420 TAGAGCCTGAATTTAAATTCTGG + Intergenic
1016764440 6:147776275-147776297 CAGAGTTTGAAATAATTTTTAGG - Intergenic
1017636881 6:156452793-156452815 CAGAGATTGAAATGAAGTTCAGG - Intergenic
1019053961 6:169206762-169206784 GAGAGATTGAAATAAATTTTGGG + Intergenic
1020994980 7:15252080-15252102 CAGATCTTCAGTTAAACTTCTGG - Intronic
1021054592 7:16032171-16032193 CAGAGCTTGATTAAAAATTAAGG - Intergenic
1021192553 7:17638534-17638556 AAATGTTTGAATTAAATTTCAGG - Intergenic
1022040375 7:26575689-26575711 CAGAGCTTGAAACAGATTTCTGG - Intergenic
1022616350 7:31934742-31934764 CTGACCTTGAGTAAAATTTCTGG - Intronic
1022709039 7:32834431-32834453 GAGAGCTGGAATTTAATTTTTGG - Intergenic
1026128532 7:67600911-67600933 CAGAGCTAGAATTGAAATCCAGG + Intergenic
1028532527 7:91853114-91853136 CATATCTTGAATTGATTTTCTGG - Intronic
1029010944 7:97261588-97261610 CAGAGCATGAGTTCAATTCCTGG + Intergenic
1030445802 7:109645760-109645782 GAGAGCTAGAATTTAATTTTTGG + Intergenic
1030468531 7:109933775-109933797 AAGTTCCTGAATTAAATTTCTGG - Intergenic
1031603588 7:123743386-123743408 CAGAGCATGGACTAAAATTCAGG + Intronic
1032749598 7:134825285-134825307 CAGAGCTGGAAGTGAAGTTCAGG - Intronic
1036043161 8:5109109-5109131 CAGAACTGGAAATAAATTTCGGG - Intergenic
1037011033 8:13842573-13842595 GAAAGCTGGAATTAAATTTTTGG + Intergenic
1037074514 8:14697231-14697253 CAATGCTTGAATTCAAATTCTGG + Intronic
1038516179 8:28189414-28189436 CTGAGCTTGAGTTAAAAATCAGG + Intronic
1039146913 8:34457675-34457697 CAGATTTTGAACTAAATTTTTGG + Intergenic
1039667891 8:39555862-39555884 TAAAGCTTGTATTAAATTTAAGG + Intergenic
1039689337 8:39847063-39847085 CAGAGCTTATTTTAAATGTCTGG + Intergenic
1041752853 8:61279812-61279834 CAGAGTCTGAATAAAATTTTTGG + Intronic
1041918080 8:63155831-63155853 CATAGGTTGAACTAAATTTGGGG - Intergenic
1042826586 8:72985959-72985981 CAGAGTTTTGATTAAACTTCTGG - Intergenic
1043290452 8:78593663-78593685 CAGAGTTTGAATAAAGTTTTTGG - Intronic
1045021565 8:98049152-98049174 CAGGGATTTAAATAAATTTCTGG - Intergenic
1045270855 8:100660342-100660364 GAGAGCCTGGATTCAATTTCTGG - Intronic
1045571781 8:103375096-103375118 CAGTGCTTGGATAACATTTCTGG - Intronic
1045840925 8:106579707-106579729 AACAGCTTGAATTTAATTCCTGG - Intronic
1046057083 8:109091724-109091746 CAGAGATTCAATTATATTTTAGG + Intronic
1046154095 8:110264494-110264516 CAGAGCTGGATTTCAAATTCAGG + Intergenic
1046868254 8:119174862-119174884 CAGAGCTTGCATTAAATGAGGGG + Intronic
1047100747 8:121673336-121673358 TAGAGCTTGGATTTCATTTCTGG + Intergenic
1047366767 8:124218331-124218353 GAGAGCTGGAATTTAATCTCAGG + Intergenic
1047866150 8:129026420-129026442 CAGACCTAGATTTAAAATTCAGG - Intergenic
1050116700 9:2270965-2270987 CAGAGCTAGAATTCAAATCCAGG + Intergenic
1050583065 9:7081391-7081413 CAGAGCTTTAAATAACTTTAGGG + Intergenic
1051144675 9:14014200-14014222 CAGAGCTTGAATTATAACCCAGG + Intergenic
1052161487 9:25265680-25265702 CAGTTCTTGAATTAAATCTGTGG - Intergenic
1052650174 9:31291768-31291790 CAGATCTTGAATTATTTTACTGG - Intergenic
1052676048 9:31625893-31625915 CACAGCTTGAATAGAGTTTCAGG + Intergenic
1055100094 9:72455297-72455319 CAGGGCTTGCAGTAAATTTGAGG - Intergenic
1056892396 9:90507603-90507625 TAGAGATGGAATTAAAATTCAGG + Intergenic
1058083706 9:100726371-100726393 CAGTCCATGAATTAAAGTTCTGG + Intergenic
1058949102 9:109886578-109886600 CAGAGCTAGAATTAACATCCTGG - Intronic
1059497759 9:114723711-114723733 CAGAGCTTTAGTTATGTTTCGGG + Intergenic
1059691834 9:116692596-116692618 TAGAGCTTGAATTCAAATCCAGG + Intronic
1059701953 9:116783650-116783672 CAGAGGTTGAATTCAATTTCAGG + Intronic
1059904712 9:118969848-118969870 CAGGGTTTGAATTCAGTTTCAGG - Intergenic
1060415137 9:123424684-123424706 CAGAGCAAGAATTAAAATCCAGG - Intronic
1060770912 9:126331724-126331746 CAGAGCTGGAATTCAAGCTCGGG + Intronic
1061457455 9:130709390-130709412 CAATGCTGGAATTAAATTTCTGG - Intergenic
1061772528 9:132937133-132937155 CAGGGCTTGAATTAAAGTGCAGG + Intronic
1185799831 X:3000361-3000383 CACAGCTTGAATAAAATATGAGG - Intergenic
1186027767 X:5332513-5332535 CAGAGCTTGCAATAAAATTATGG + Intergenic
1187115566 X:16346815-16346837 CTGAGCTGTAATTAAATTGCTGG - Intergenic
1187373507 X:18729920-18729942 CAGAGCTAGGATTCAAGTTCAGG + Intronic
1187399253 X:18945092-18945114 CGGAGCTTGCATTCAATTCCGGG + Exonic
1187633782 X:21204683-21204705 CTGAACTTGAATCATATTTCAGG - Intergenic
1188001311 X:24985042-24985064 AAGAGCATGAATTAAATTTGTGG + Intronic
1188107585 X:26162877-26162899 CAGAGCTGGGATTAGATCTCTGG + Intergenic
1188110975 X:26196106-26196128 CAGAGCTGGGATTAGATCTCTGG + Intergenic
1188362116 X:29267863-29267885 CAAAGCCTCAATTCAATTTCTGG - Intronic
1188868933 X:35349937-35349959 CACACCTTGAACTAAGTTTCAGG - Intergenic
1189370189 X:40421789-40421811 CAGAGCTGGAATTCAAATTCAGG + Intergenic
1189592950 X:42534824-42534846 CAGAGCCTGAGATAAAATTCAGG - Intergenic
1190393528 X:49956305-49956327 CAGAGCTAGAATTCAAATCCAGG - Intronic
1191010911 X:55757921-55757943 GAGAGATTAATTTAAATTTCTGG - Intronic
1192192856 X:69003681-69003703 CTGTGATTGAATTAAATTTATGG + Intergenic
1192232606 X:69276387-69276409 CAGAGCTGGAATTTAAATCCTGG + Intergenic
1193676965 X:84466430-84466452 CAGAGCTTGAATTTGAATCCAGG + Intronic
1194111682 X:89841707-89841729 CAGAGGTGGAATTCAATCTCAGG - Intergenic
1195956561 X:110337091-110337113 CAGAGCTGGAATTCAAATCCAGG - Intronic
1196562915 X:117172734-117172756 CAGAGCCTGGATTGAATTCCAGG + Intergenic
1196745183 X:119065451-119065473 CAGAGCTTGGGTTAAAATCCAGG + Intergenic
1198258324 X:134944705-134944727 CAGTGCTTAAACTAAATTTGTGG + Intergenic
1199806260 X:151303712-151303734 TAGAGTTTGAATTAAAATACTGG - Intergenic
1200464344 Y:3496498-3496520 CAGAGGTGGAATTCAATCTCAGG - Intergenic
1200685734 Y:6257127-6257149 TAGAGCGAGAATTAACTTTCCGG - Intergenic
1200991265 Y:9348371-9348393 TAGAGCGAGAATTAACTTTCCGG - Intergenic
1200993923 Y:9368663-9368685 TAGAGCGAGAATTAACTTTCCGG - Intronic
1200996586 Y:9388982-9389004 TAGAGCGAGAATTAACTTTCCGG - Intergenic
1200999101 Y:9457536-9457558 TAGAGCGAGAATTAACTTTCCGG - Intergenic
1201001754 Y:9477845-9477867 TAGAGCGAGAATTAACTTTCCGG - Intronic
1201004421 Y:9498147-9498169 TAGAGCGAGAATTAACTTTCCGG - Intergenic
1201007074 Y:9518459-9518481 TAGAGCGAGAATTAACTTTCCGG - Intergenic