ID: 913303783

View in Genome Browser
Species Human (GRCh38)
Location 1:117401468-117401490
Sequence TGGATTGGGGTGGATATAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913303775_913303783 -2 Left 913303775 1:117401447-117401469 CCACTCTTGTATTCATTCCTGTG 0: 1
1: 0
2: 1
3: 35
4: 275
Right 913303783 1:117401468-117401490 TGGATTGGGGTGGATATAGAGGG 0: 1
1: 0
2: 1
3: 24
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913303783 Original CRISPR TGGATTGGGGTGGATATAGA GGG Intronic
901656893 1:10774548-10774570 TGGATCGGGGGGGCTATGGATGG - Intronic
903821798 1:26108861-26108883 TGGGTTGGAGGGGATAGAGATGG - Intergenic
906250035 1:44303995-44304017 TTAATTGGTGTGGATAGAGAAGG + Intronic
909563711 1:77032330-77032352 TGGATTGAGGTGGATGTAGGAGG + Intronic
909687681 1:78368997-78369019 TGGCTAGGGGTGGAAGTAGAGGG + Intronic
909733397 1:78925125-78925147 TAGATTGGGATGGATGTAGTGGG + Intronic
912878787 1:113389498-113389520 GGGAGTGGGGTGGAGGTAGAAGG - Intergenic
913296299 1:117323801-117323823 TGGATTGGGGTAGGTCAAGAGGG + Intergenic
913303783 1:117401468-117401490 TGGATTGGGGTGGATATAGAGGG + Intronic
913484247 1:119319378-119319400 TGGAGTGGGGTGGCAATGGAAGG - Intergenic
917511112 1:175670015-175670037 TGGGTTGGGCTGGCTATACATGG - Intronic
920628575 1:207628316-207628338 TTGCTTTGGGTGGATATAGGTGG - Intronic
920688186 1:208125917-208125939 GTGATTGGGGTGGATTGAGATGG + Intronic
921582021 1:216906196-216906218 TGGAATGGAGGGGATATATAAGG - Intronic
923064810 1:230507964-230507986 TGGGTTGGTTTGCATATAGAAGG + Intergenic
923078377 1:230630576-230630598 TGAATTGGTGTGGAGAGAGAAGG + Intergenic
923693777 1:236225587-236225609 TGCATTGGGATGGATATGTAAGG - Intronic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1064898732 10:20270183-20270205 TGAATTGGGGTATTTATAGAGGG + Intronic
1066634189 10:37484834-37484856 TGGATTAAGGTGGTTCTAGAAGG + Intergenic
1066941082 10:41880329-41880351 TGGAATGGAGTGGATATAAATGG + Intergenic
1067398846 10:45951806-45951828 GGGAATGGGGTGGAGAAAGAAGG + Intergenic
1067867167 10:49921042-49921064 GGGAATGGGGTGGAGAAAGAAGG + Intronic
1070417916 10:76207596-76207618 TAGGTAGGGGTGGATAAAGAGGG - Intronic
1074172299 10:110953806-110953828 TGGATTGGGGGGAATAGAAAAGG + Intronic
1074420998 10:113308999-113309021 GGGAATGGGGAGGAAATAGATGG + Intergenic
1074592518 10:114826585-114826607 AGGATTGGAGTTGTTATAGAAGG + Intronic
1075723146 10:124598803-124598825 TGGATGGGGATGGACAGAGAAGG - Intronic
1077480230 11:2811164-2811186 TGGATTGGGGTAGCTGTACAGGG - Intronic
1079374454 11:19879663-19879685 AGGATTGGAGTGGATACAGGAGG - Intronic
1080980283 11:37394867-37394889 TGGATGGGGGTGGAATTCGAGGG + Intergenic
1084883556 11:72189060-72189082 TTGACTGGGGTGGAGATGGAGGG + Intergenic
1085462544 11:76702785-76702807 TGCAATGGGGTGAACATAGAGGG - Intergenic
1089610009 11:119663850-119663872 GGGAATGAGGTGGAAATAGACGG + Exonic
1089879717 11:121762206-121762228 TGAATTGTGGTTGAGATAGAGGG + Intergenic
1090403543 11:126463936-126463958 TGGATAGGGGAGGAAATAGGTGG + Intronic
1090521543 11:127485146-127485168 TGGACTTTGGTAGATATAGAAGG + Intergenic
1091402369 12:188869-188891 TGGATGGGGGTGGGGATGGAGGG - Intergenic
1091932773 12:4410065-4410087 GGGACTGGGGTGGATTGAGAAGG + Intergenic
1092045335 12:5428477-5428499 TGGATGGGGGTGGGGATGGAGGG + Intergenic
1092289388 12:7150181-7150203 TGGAAAGGAGTGGAAATAGAAGG - Intronic
1094425942 12:30317139-30317161 TGGATTGGACTGGATAAAGCAGG - Intergenic
1094673457 12:32594552-32594574 TGGGTTGGGGTGGGGAGAGAGGG - Intronic
1095202062 12:39395922-39395944 TGGAGTGGGGTGTTTAGAGAGGG - Intronic
1099338159 12:81391914-81391936 AGGGTGGGAGTGGATATAGATGG + Intronic
1100842621 12:98629170-98629192 TTGATTGGGGTGGACCTAGAAGG - Intronic
1102781536 12:115570103-115570125 GGGTTTGGGCTGGATATTGAGGG - Intergenic
1102895653 12:116596011-116596033 TGGATTGGTGGGGAGATGGATGG + Intergenic
1103902841 12:124312144-124312166 GGGCGTGGGGTGGATACAGAGGG - Intronic
1103948667 12:124540519-124540541 GGGATGGGGGTGGAGATGGAGGG + Intronic
1103948785 12:124540835-124540857 GGGATGGGGGTGGAGATGGAAGG + Intronic
1103949097 12:124541763-124541785 GGGATGGGGGTGGATATGGAGGG + Intronic
1103949107 12:124541785-124541807 GGGATGGGGGTGGATATGGAGGG + Intronic
1105264702 13:18805373-18805395 TGGGTGGGGGTGGATGTGGAAGG - Intergenic
1106769245 13:32945593-32945615 AGGCTTGGGGTGGGGATAGATGG + Intergenic
1107041379 13:35951514-35951536 TGGATTAGAGTGGATAGAGAAGG - Intronic
1108308188 13:49159657-49159679 TGAATAGGGGTGGAGAGAGAGGG + Intronic
1109395470 13:61752939-61752961 TGGATTGAGGCAGATATGGAGGG - Intergenic
1109610834 13:64762737-64762759 TGGATTGGGGTGGAATGATATGG + Intergenic
1110359356 13:74607834-74607856 TGGTCTGGGGTGGAAATAAAGGG + Intergenic
1112765268 13:102735062-102735084 TGAAGTGGGGAGGATCTAGAAGG + Exonic
1117356729 14:54931357-54931379 TGGATTGGAATTGATATAGATGG - Intergenic
1120200471 14:81533474-81533496 TGGAGTGGGGTGGAAAAAGAAGG - Intronic
1120468845 14:84897012-84897034 TGGAGTGGAGTGGGTATAAAAGG - Intergenic
1121157634 14:91701486-91701508 AGGATTTGGGTGGATAGAGCGGG + Intronic
1202833751 14_GL000009v2_random:62688-62710 TGGGTGGGGGTGGATGTGGAAGG + Intergenic
1125319274 15:38466288-38466310 TGTATTGGGATGGAGAGAGAGGG - Intronic
1128476778 15:68004285-68004307 TGGATTGGGGCAGAAAGAGATGG + Intergenic
1129172513 15:73816894-73816916 TGGATGGGGGTGGAAATAAAGGG - Intergenic
1130693171 15:86104178-86104200 GGTATTGGGGAGGATAAAGATGG + Intergenic
1134008297 16:10833094-10833116 TGGGTTGGGGTGCACATGGATGG - Intergenic
1138939556 16:61773999-61774021 TGGGTAGGGGTGGATAAGGATGG + Intronic
1142254373 16:89006815-89006837 GGGAGTGGGGAGGAGATAGAGGG - Intergenic
1144859053 17:18288617-18288639 TGGAGGGGGGTGGCCATAGAAGG - Intronic
1147862210 17:43530212-43530234 TGGCTTGGGGTGGAGCTCGAGGG + Intronic
1148840583 17:50493731-50493753 AGGATTGGGAAGGATATACATGG - Intergenic
1149355283 17:55833063-55833085 TGGACTGAGGTGGTTAGAGATGG + Intronic
1150357282 17:64497360-64497382 TTGATTGAGGTGTATATAGAAGG - Intergenic
1152238434 17:79150070-79150092 GGGTTTGGGGTGGATCTAGTTGG + Intronic
1153527882 18:6014971-6014993 TGAAGTGGGGTGGATATAAGGGG + Intronic
1153576043 18:6523020-6523042 TGGATTATGGTGGAGAGAGAGGG + Intronic
1154423694 18:14256188-14256210 TGGGTGGGGGTGGATGTGGAAGG + Intergenic
1155837120 18:30599766-30599788 TGGGTTGGGATGGACATAGAAGG + Intergenic
1156637552 18:39049534-39049556 TGGATGAGGATGGACATAGATGG + Intergenic
1158831443 18:61283721-61283743 TGGAATGGGGTGCAGGTAGAAGG + Intergenic
1160755496 19:754974-754996 TGGCTTGGGGTGGAGGAAGAGGG + Intronic
1163360440 19:16842734-16842756 TGGATTGGGGTGGAAAAGAAAGG + Intronic
1165794687 19:38511990-38512012 GCGGTTGGGGTGGATGTAGAGGG + Intronic
1202638921 1_KI270706v1_random:65004-65026 TGGGTGGGGGTGGATGTGGAAGG - Intergenic
925861973 2:8187404-8187426 TGGATTGTGGTGGATTATGAAGG + Intergenic
926119930 2:10236322-10236344 AGGATGGGGGTGGATACAGATGG - Intergenic
926215127 2:10901676-10901698 TGGATGGAGGTGGGTAGAGAAGG - Intergenic
927261211 2:21092985-21093007 TGGATTGGAGTGAAAAAAGAAGG - Intergenic
927576910 2:24207984-24208006 TGGAGTGGGGGGGATAGAGGTGG + Intronic
928037586 2:27839445-27839467 GGGATGGGGGTGGCTATACAGGG + Intronic
928275372 2:29895866-29895888 TGGCTTGGGGTGAAGAAAGAGGG + Intronic
929341049 2:40818243-40818265 TGTTTTGTGGTGGATATAGTTGG - Intergenic
929915415 2:46131542-46131564 TGGAGTGGGGAGGAAAGAGAGGG + Intronic
933236666 2:79871713-79871735 TGGATTGAGGGGTATCTAGAAGG - Intronic
933569062 2:83987409-83987431 TGGTTTCTGGGGGATATAGAAGG - Intergenic
933586796 2:84187948-84187970 TAGATTTGGGTGGGTATAGAGGG - Intergenic
933679226 2:85084332-85084354 TGGGTAGGGGTGGGTATAAAAGG + Intergenic
934657884 2:96125499-96125521 AGGAGAGGGGTGGATATAGCGGG - Intronic
936451090 2:112634591-112634613 GGGATAGGGGTGGAGACAGAAGG - Intergenic
936752061 2:115655576-115655598 TTGATTGGTTTGGATATATAGGG + Intronic
936776313 2:115977730-115977752 CGGATCCAGGTGGATATAGATGG + Intergenic
941600038 2:167531279-167531301 TGGATTGGGGTGGAGTTGGCAGG + Intergenic
941684977 2:168438959-168438981 TGAATTAGGGGGGTTATAGAAGG + Intergenic
942525187 2:176845516-176845538 TGGGTTGGGGTGGAGAAACAGGG + Intergenic
943515638 2:188882513-188882535 TGGATAAGGCTGGATAAAGAAGG + Intergenic
943709051 2:191069470-191069492 TGGAATTGGTTGGATATAGATGG + Intronic
944167534 2:196738941-196738963 TGGAATGGGGTGGTGAGAGAGGG + Intronic
1168729831 20:66755-66777 TGGAGTGGAGTGGATAGGGATGG - Intergenic
1172179924 20:32996644-32996666 TGGATTGGAGTGTAAATAGATGG - Intronic
1176849778 21:13903820-13903842 TGGGTGGGGGTGGATGTGGAAGG - Intergenic
1177230677 21:18316442-18316464 TGGATTGGGTCGGAAACAGAAGG + Intronic
1178937806 21:36879556-36879578 TGGAATGGGGTGGGTTTATAAGG + Intronic
1179445836 21:41429639-41429661 AGGATTGGGATGGTTATAAAAGG - Intronic
1180877313 22:19180624-19180646 TGGATGGGGATGGGAATAGATGG - Intronic
1181913913 22:26263810-26263832 GGGATTGAGTTGGATAGAGACGG - Intronic
1183531903 22:38360940-38360962 TGGACAGGGGTGGAAATAGTGGG - Intronic
1203305485 22_KI270736v1_random:106137-106159 TGGATTGGGGTGGAATGATATGG + Intergenic
1203307764 22_KI270736v1_random:121408-121430 TGCAGTGGGGTGGATATGAATGG + Intergenic
1203308493 22_KI270736v1_random:126117-126139 TGGATTGGAGTGGAAAGGGATGG + Intergenic
949246662 3:1932812-1932834 TGAATAGGAGTGGTTATAGAGGG - Intergenic
950220545 3:11191986-11192008 AAGATTGGGGTGGACAAAGATGG + Intronic
950630791 3:14280321-14280343 TGCATTGGGGTGGGGGTAGAAGG + Intergenic
951696847 3:25453858-25453880 GGGTTTGGGGTGGCTAGAGAGGG - Intronic
951800425 3:26589763-26589785 AGGATTGAGGTGGATCCAGAAGG - Intergenic
952475480 3:33705383-33705405 TAGGTTGGGGTGGGTATGGAGGG + Intronic
952668558 3:35937811-35937833 TGGAGAGGGGTGAATAAAGAAGG - Intergenic
953454490 3:43030823-43030845 TGGATTGTGGGGGATAGAGGTGG + Intronic
953974974 3:47375577-47375599 TGGAGTGGGGTGGTTGCAGATGG - Intergenic
955397133 3:58565607-58565629 TGGGATGGGGTGGATAATGAAGG + Exonic
955411403 3:58657828-58657850 TGGGTTTGGGTGGCTACAGAGGG - Intronic
956854332 3:73261055-73261077 TGGAAGGGTGTGGATAGAGAAGG + Intergenic
957938894 3:86978941-86978963 TGGTTTGGGGAGGAAAAAGATGG - Intronic
962781898 3:138726998-138727020 TGGAGTGGAGTGGATAAACACGG - Intronic
962830641 3:139136314-139136336 TGGTTTGGAGTGGATGTAGGAGG + Intronic
963057681 3:141200765-141200787 TGGATTGGTGAGTAGATAGATGG + Intergenic
963155497 3:142091699-142091721 TGGATGGGGGTGGAGAGAGATGG + Intronic
963554272 3:146768040-146768062 TGGATTTGGGTACATTTAGATGG + Intergenic
965538783 3:169851908-169851930 TGGTTTGGGGTGTATAAAGGAGG - Intronic
966551065 3:181204586-181204608 TGGAATGGGTTAGTTATAGACGG + Intergenic
968560403 4:1277917-1277939 TGGATGGGGGTGGAAATGGGAGG - Intergenic
970641085 4:18066657-18066679 TAGATTGGGGTGGATAGGAAGGG + Intergenic
973391872 4:49564032-49564054 TGGGTGGGGGTGGATGTGGAAGG + Intergenic
973805620 4:54523424-54523446 TGGATTAGGGTGGTGGTAGAGGG + Intergenic
976381099 4:84399958-84399980 TGGATTTGGGAGGATATAGAGGG + Intergenic
976661158 4:87542014-87542036 TAGATTGGGTTGGAAAGAGAAGG - Intergenic
977010128 4:91625153-91625175 GGGATTGGGGTGCAGAGAGAGGG - Intergenic
977298607 4:95240456-95240478 TGGACTGGAGTGGATACAGGAGG + Intronic
977859832 4:101943477-101943499 TGGATTGGTGTGGGGATGGAAGG + Intronic
981167971 4:141584536-141584558 TGGCTTGGGTTTGTTATAGATGG - Intergenic
982122694 4:152157853-152157875 CGCCTTGGGGTGGAGATAGATGG - Intergenic
984360377 4:178722477-178722499 TGAATTAGGTTGGATAAAGATGG + Intergenic
1202766268 4_GL000008v2_random:150863-150885 TGGGTGGGGGTGGATGTGGAAGG - Intergenic
990431810 5:55742884-55742906 TGGTGTGGGGTGGATTTAGTTGG + Intronic
991564721 5:67992883-67992905 TGGAATGGGGTGAATACAAAAGG + Intergenic
991723926 5:69517233-69517255 GGGAGTGGGGTGGCTAAAGATGG + Intronic
991735065 5:69624307-69624329 TGGAGTGGGGTGGAGAGAGGAGG - Intergenic
991735170 5:69625171-69625193 TGGAGTGGGGTGGAGAGAGAAGG - Intergenic
991779808 5:70121548-70121570 TGGAGTGGGGTGGAGAGAGAAGG + Intergenic
991779914 5:70122412-70122434 TGGAGTGGGGTGGAGAGAGGAGG + Intergenic
991811498 5:70479443-70479465 TGGAGTGGGGTGGAGAGAGGAGG - Intergenic
991811604 5:70480307-70480329 TGGAGTGGGGTGGAGAGAGAAGG - Intergenic
991859095 5:70996977-70996999 TGGAGTGGGGTGGAGAGAGAAGG + Intronic
991859201 5:70997840-70997862 TGGAGTGGGGTGGAGAGAGGAGG + Intronic
991872255 5:71121869-71121891 TGGAGTGGGGTGGAGAGAGAAGG + Intergenic
991872361 5:71122733-71122755 TGGAGTGGGGTGGAGAGAGGAGG + Intergenic
993123220 5:83800774-83800796 TGGACTGGGGGGGATACAGTTGG - Intergenic
993274100 5:85834423-85834445 TAGATAGTGGTGGATAAAGAGGG + Intergenic
995123113 5:108556099-108556121 TGGATTGGAGGGGGTACAGAGGG + Intergenic
997234943 5:132267370-132267392 GGGATTGGGGTAGATAGTGAGGG - Intronic
997298938 5:132788226-132788248 GGGGTTGGGGGGAATATAGAGGG + Intronic
1001243130 5:170085385-170085407 AGGCTTGGTGTGGATAGAGATGG - Intergenic
1003943452 6:11051352-11051374 TGGATTGGGATGGCTATCGCAGG - Intergenic
1004219448 6:13733136-13733158 TAGATTGGGGTGATTAGAGAAGG - Intergenic
1006673617 6:35746166-35746188 GGGATGGGGGTGGTTAGAGAAGG + Intronic
1006974001 6:38079815-38079837 GAGATTGGGGTGGACATAGGAGG - Intronic
1007368292 6:41409460-41409482 TGGAGTGGGGAGGAGAGAGAGGG + Intergenic
1008590744 6:52991366-52991388 TGGATTGGGGTTGATATCACAGG + Intronic
1010149782 6:72718041-72718063 TGCTTTGGGGTGGCCATAGAGGG - Intronic
1012065602 6:94546612-94546634 TGGATTTTGGTAGATATAAAAGG + Intergenic
1014640641 6:123905266-123905288 TGCTTTGGGGTTGACATAGAGGG + Intronic
1015372222 6:132466986-132467008 TGGATTAGGATGGAACTAGAGGG - Intronic
1016363724 6:143293905-143293927 TGGAGGGGAGTGGATAGAGATGG - Intronic
1016980057 6:149845882-149845904 TGGATTGGAGGTGAGATAGAAGG - Intronic
1016982956 6:149869668-149869690 TAAATTGGGGTGTATATAGTGGG + Intergenic
1018401577 6:163426459-163426481 TGGATTAGAGTGGTGATAGATGG + Intronic
1021314203 7:19126132-19126154 TGGCTTCGGGTGGTAATAGATGG - Intergenic
1021554929 7:21909552-21909574 TGGCTTGGTGTGGATATACCAGG - Intronic
1022493231 7:30836799-30836821 TTGATTTGAATGGATATAGATGG + Intronic
1022628320 7:32061301-32061323 TGGATTTGGGTAGAAATAGAAGG + Intronic
1022638378 7:32159016-32159038 TGGATTATGGTGGACATAAAAGG - Intronic
1026192572 7:68142882-68142904 TGGATGTGGCTGGATATGGATGG + Intergenic
1033153516 7:138936905-138936927 TGGATTGGAGGGGATAGAGGAGG - Intronic
1033608177 7:142942531-142942553 TGGGTAGGGGTGGGTAGAGAAGG + Intronic
1036937316 8:13015677-13015699 TGGAATGGTCTGGATATAGGTGG - Intronic
1038119763 8:24599892-24599914 GGGATTGGCGTGGCTATAAAAGG - Intergenic
1038521869 8:28240657-28240679 AGGATGGGGGTGGTTATAAAAGG + Intergenic
1043543427 8:81288770-81288792 TGGAGTGGGGTGGTTATCGCAGG - Intergenic
1044190503 8:89310843-89310865 ATGATTGGGGTGGGGATAGATGG - Intergenic
1047641860 8:126829022-126829044 TGGATAGGGGCTGGTATAGATGG - Intergenic
1048377259 8:133833661-133833683 TGGCTTGGTGTGGGTATGGAGGG - Intergenic
1049840032 8:144765107-144765129 TGAATTCAGGTGGATATGGAAGG + Intergenic
1053133509 9:35634322-35634344 TGGGATGGGGAGGAAATAGAAGG - Intronic
1053275950 9:36783399-36783421 TGGGGTGGGGTGGTTAGAGACGG + Intergenic
1055324934 9:75119233-75119255 TGGAGTGGGGTGAATATTGAAGG + Intronic
1057226435 9:93295748-93295770 TGGAGAGGGGAGGATAGAGAGGG - Intronic
1057922569 9:99109331-99109353 TGAATTGGGGTGTAGTTAGAAGG + Intronic
1058748424 9:108015239-108015261 TGGATTGGGGTGGTGATATCTGG - Intergenic
1058856836 9:109070744-109070766 TGGATTGGGGTGGAGCTCTAGGG - Intronic
1059959841 9:119554236-119554258 TGGATTGGGGTGAAGAGGGAGGG + Intergenic
1062039790 9:134399000-134399022 TGGATTGGCTTGGATAAGGAGGG + Intronic
1203342351 Un_KI270442v1:1652-1674 TGGATTGGAGTGGATTTGAATGG + Intergenic
1203350894 Un_KI270442v1:80504-80526 TGGATTGGAGTGGATAGGAACGG + Intergenic
1203395232 Un_KI270512v1:21578-21600 TGGATTGGAGTGGATTAAAATGG + Intergenic
1186205209 X:7192833-7192855 TGGAGTGGGGTGCATGTAGTGGG + Intergenic
1188485777 X:30680431-30680453 GGGGTTGGTGAGGATATAGAGGG + Intronic
1189599062 X:42602040-42602062 TGGATTGTGGACAATATAGAAGG + Intergenic
1189826273 X:44921492-44921514 GGGATTGGTGTGGCTATAAAGGG - Intronic
1190654333 X:52597956-52597978 TGGCTTGGGCTGGATAAAAATGG - Intergenic
1190680272 X:52820605-52820627 TGGCTTGGGCTGGATAAAAATGG + Intergenic
1194747460 X:97644034-97644056 GGGATCGGGGTGGAGATACAGGG - Intergenic
1196152287 X:112388450-112388472 TGAATTGGAGTGGTGATAGAGGG + Intergenic
1198083198 X:133259086-133259108 AAAATTGGGGTAGATATAGAGGG + Intergenic
1199611744 X:149623155-149623177 TGGAGAGGGGAGGATAAAGAGGG - Intronic
1199895855 X:152127449-152127471 TGGAAGGGGGTGTATATATAGGG + Intergenic
1201100982 Y:10672528-10672550 TGGATTGGAGTGGAATTAAATGG - Intergenic
1201110200 Y:10793621-10793643 TGGATTGGGGTGGAATTGAATGG - Intergenic
1201121210 Y:10874974-10874996 TGGAGTGGAGTGGATATGAATGG - Intergenic
1201123178 Y:10888762-10888784 TGGAATGGAGTGGATATGAATGG - Intergenic
1201127471 Y:10927938-10927960 TGGAGTGGGGTGGAGATAACTGG - Intergenic
1201198832 Y:11520680-11520702 TGGATTGGGGTAGAAAGAAATGG + Intergenic
1201211385 Y:11683914-11683936 TGGAATGGGGTGGATTCTGATGG + Intergenic
1201577930 Y:15479876-15479898 TGGAGTGGGGTGCATGTAGTGGG + Intergenic