ID: 913304997

View in Genome Browser
Species Human (GRCh38)
Location 1:117419370-117419392
Sequence TTGACTAAATATGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913304997_913305001 13 Left 913304997 1:117419370-117419392 CCTTCCTCCTCATATTTAGTCAA 0: 1
1: 0
2: 1
3: 20
4: 219
Right 913305001 1:117419406-117419428 CCCTGTAGTATGTTAGATGTTGG 0: 1
1: 0
2: 1
3: 17
4: 140
913304997_913305003 14 Left 913304997 1:117419370-117419392 CCTTCCTCCTCATATTTAGTCAA 0: 1
1: 0
2: 1
3: 20
4: 219
Right 913305003 1:117419407-117419429 CCTGTAGTATGTTAGATGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913304997 Original CRISPR TTGACTAAATATGAGGAGGA AGG (reversed) Intronic
903695160 1:25201051-25201073 GGGACTAAATATGATGAGGTGGG - Intergenic
904262526 1:29297910-29297932 TTGACTGATGGTGAGGAGGAAGG + Intronic
909523301 1:76594021-76594043 CTGACTAAATAAGGGGAGAAGGG - Intronic
910438449 1:87228787-87228809 TTGACTACAGAAGAGGAAGAAGG + Intergenic
910823795 1:91383479-91383501 TTGATTAAAAATGAGGGAGAGGG - Intronic
912501587 1:110126234-110126256 TTGACTGAATAAGAGAAAGAAGG - Intergenic
913200835 1:116494261-116494283 CTAACTAAATATGAGCAGTAGGG - Intergenic
913304997 1:117419370-117419392 TTGACTAAATATGAGGAGGAAGG - Intronic
913567518 1:120087466-120087488 GTGACCAAATATGAGGAGCAAGG + Intergenic
914288266 1:146248173-146248195 GTGACCAAATATGAGGAGCAAGG + Intergenic
914549302 1:148698919-148698941 GTGACCAAATATGAGGAGCAAGG + Intergenic
914617382 1:149372799-149372821 GTGACCAAATATGAGGAGCAAGG - Intergenic
914982080 1:152423950-152423972 CACACTAAAGATGAGGAGGAAGG - Intergenic
916729855 1:167556199-167556221 TTGGCTGAATATTAGGAGGCTGG - Intergenic
917530342 1:175829435-175829457 CTCACTAGATAGGAGGAGGAGGG - Intergenic
919505191 1:198389501-198389523 TTCAGTAAATATGATGAGAAAGG + Intergenic
919553835 1:199027003-199027025 TTTAAGAAATAAGAGGAGGAAGG - Intergenic
920523888 1:206651177-206651199 ATGAATAAAGAAGAGGAGGATGG - Intronic
924891229 1:248282625-248282647 TTGAATAAATGTGATGAGAAAGG + Intergenic
1068588496 10:58828156-58828178 TTGACTACATGGGAGCAGGAGGG + Intronic
1069179198 10:65334655-65334677 TTAACTAAATACAAGGAGGTAGG + Intergenic
1069696696 10:70391762-70391784 CTGATTAGATATGAGGAGTAAGG + Intergenic
1070650879 10:78235346-78235368 TTGACATAAGATGAGGACGAGGG + Intergenic
1072368530 10:94740409-94740431 TTCCCAAAAAATGAGGAGGAGGG - Intronic
1074748475 10:116559546-116559568 TTGACTGAATATAAAGAGGCTGG - Intronic
1075868177 10:125745619-125745641 TTGATGAGATAAGAGGAGGATGG - Intronic
1077316977 11:1923701-1923723 GTGACTAATGATGAGGAAGATGG - Intronic
1080299378 11:30767621-30767643 TTGACTACAAAAGAGGAGGTAGG - Intergenic
1080711897 11:34756606-34756628 TTGACTTAACATCAGGAGGCAGG + Intergenic
1080727014 11:34908532-34908554 TTGACTGATGAGGAGGAGGAGGG - Intronic
1081010058 11:37799826-37799848 TTCTCAAAAAATGAGGAGGAGGG + Intergenic
1081388403 11:42500524-42500546 TTGTCCAGATATAAGGAGGAGGG + Intergenic
1082878920 11:58018863-58018885 TTGGTTAATTTTGAGGAGGAGGG + Intergenic
1083688915 11:64394714-64394736 GTGAAGAAATGTGAGGAGGAGGG + Intergenic
1085064758 11:73484081-73484103 TTGACTGAAGATAAGGAGGGAGG - Intronic
1085836829 11:79965986-79966008 GTGGCTAAAGAAGAGGAGGAGGG - Intergenic
1087715620 11:101605443-101605465 TTGACTACATATTAGGGAGATGG - Intronic
1088348677 11:108860450-108860472 TTGACTAAGTGTTAGGAGTATGG - Intronic
1088739962 11:112759090-112759112 GTCACTAAATATAAGGAGGGAGG + Intergenic
1089151595 11:116368714-116368736 TTCACTAAAGAAGGGGAGGAAGG + Intergenic
1089574347 11:119431034-119431056 TTGGATAAATATAAGGAGTAAGG + Intergenic
1090523145 11:127500302-127500324 ATGATTAAATGTGGGGAGGAAGG + Intergenic
1090537935 11:127665784-127665806 TGCACTAAACATGAGGAGTATGG + Intergenic
1091697641 12:2638760-2638782 TGGCCTAAATCAGAGGAGGATGG + Intronic
1092068776 12:5615531-5615553 TTGAGTAGACAAGAGGAGGAAGG - Intronic
1093096861 12:14981825-14981847 TTTATTAAATATGAGGAGGTGGG - Exonic
1093239756 12:16655829-16655851 TTCCATAAATTTGAGGAGGAGGG - Intergenic
1093285079 12:17249220-17249242 TTTACTAAGAATGAGGTGGAAGG + Intergenic
1093773897 12:23049917-23049939 TTGAACAAAAATGAGAAGGAAGG + Intergenic
1094305870 12:29018541-29018563 TTTAATATATATGAAGAGGAAGG - Intergenic
1094435352 12:30415063-30415085 TTGAGTAGATAAGAGGAGGTGGG - Intergenic
1094590531 12:31815286-31815308 TTAACTAAATATGTGGTGGCAGG - Intergenic
1095527503 12:43145186-43145208 TTCAATAAATATCAGGAGAAGGG - Intergenic
1096087197 12:48873682-48873704 TGGACTAAGAATGAGGAGGGAGG + Intergenic
1096698351 12:53365542-53365564 TTGACTAAGGCTGAGGAGGGAGG - Intergenic
1096907880 12:54952125-54952147 TTGGCTATATAAGAAGAGGAAGG + Intronic
1097729171 12:63108044-63108066 TTGACGAAATGTGCGGAAGAAGG - Intergenic
1100330480 12:93577201-93577223 GTGACTAATTATGAGAAGGCTGG + Intronic
1101764912 12:107688772-107688794 TTAGATAAATATGATGAGGAAGG + Exonic
1105660417 13:22487999-22488021 TGGGCCAAATAGGAGGAGGAGGG + Intergenic
1107287108 13:38806127-38806149 TTCACTAAATACAAGTAGGAGGG + Intronic
1108031373 13:46233198-46233220 TTGAGTAGAAATGAGGAAGATGG - Intronic
1108785264 13:53892828-53892850 CTGACTAAATGTGAAGAGAAGGG - Intergenic
1109299919 13:60580336-60580358 TTGTCTAAAGATGGGGAGGTAGG + Intergenic
1109352524 13:61202884-61202906 TTGATTAAATGTGAAGAGGAGGG + Intergenic
1109437984 13:62331736-62331758 TTGCCCAAATGTGAGGAGGAAGG - Intergenic
1109772784 13:66998648-66998670 CTGGCTAACTATGAGGAAGAGGG - Intronic
1110130370 13:72001572-72001594 TTGGCTAAACCTGACGAGGAAGG - Intergenic
1110637690 13:77785235-77785257 TTTACTAAATAGGAGGTGAATGG - Intergenic
1110796906 13:79649266-79649288 TTGAGTAAATATGAGAATAATGG - Intergenic
1111230230 13:85335965-85335987 TTGGATAGATATGAGAAGGAAGG - Intergenic
1111410500 13:87871021-87871043 TTGATTAAATATATGGAGCATGG + Intergenic
1111717473 13:91897049-91897071 TTGATGAAAAAGGAGGAGGAGGG - Intronic
1112634840 13:101203951-101203973 TTGACTGAAAATAAGGAGGCAGG + Intronic
1115014132 14:28589200-28589222 TTGGCTAAATATCCAGAGGATGG + Intergenic
1115063138 14:29219082-29219104 TTTACTAAAAATGTGGATGAGGG + Intergenic
1115902800 14:38172534-38172556 GTTACTAAATTTGAGGAGGTGGG - Intergenic
1116317132 14:43411474-43411496 TTGCTTTAATATGAGTAGGAAGG + Intergenic
1117314817 14:54564738-54564760 GAAACTAAATTTGAGGAGGAAGG + Intergenic
1117893199 14:60449272-60449294 TTTACCAAATCTTAGGAGGAAGG - Intronic
1118002030 14:61532143-61532165 TGGACTAAATATGTGGAGCATGG - Intronic
1118658070 14:67975422-67975444 TTGAATAAATATGATAAGGCTGG - Intronic
1118755004 14:68835888-68835910 AAGACAAAATGTGAGGAGGATGG - Intergenic
1119851048 14:77866993-77867015 ATGAGTAAATAAGAGGAGGATGG - Intronic
1121907500 14:97760268-97760290 TTTAATATACATGAGGAGGAGGG + Intronic
1122848785 14:104515449-104515471 TTGCCCAGATATGGGGAGGAAGG + Intronic
1202871028 14_GL000225v1_random:164091-164113 TTGACTAAATCTGGGGTGGGGGG + Intergenic
1127964138 15:63911490-63911512 TTGTCTAAATATTATGATGATGG + Intronic
1128850034 15:70945026-70945048 TTGGCTAAATATTAGGATGTGGG - Intronic
1131753346 15:95533848-95533870 TTGATACAATATGATGAGGATGG + Intergenic
1134776672 16:16859372-16859394 TTGACCAATTAGGAGGAGAAAGG + Intergenic
1135208525 16:20503586-20503608 TTCACTAAACATGAGGCAGATGG - Intergenic
1135827897 16:25746428-25746450 ATGACTGAATATGAGGAGTTTGG + Intronic
1136672395 16:31870138-31870160 TGGACTGAAAATGAGGAAGAAGG - Intergenic
1137717009 16:50604107-50604129 TAGACAAAATAAGTGGAGGAGGG + Intronic
1140185189 16:72763338-72763360 TTGAAGAAAGAAGAGGAGGAGGG + Intergenic
1143890253 17:10097327-10097349 TTGACTGAATGGGAGGAAGATGG + Intronic
1144070489 17:11666990-11667012 TTTACTAGGTAAGAGGAGGAGGG - Intronic
1144998162 17:19285340-19285362 TGGACTCGGTATGAGGAGGAGGG - Intronic
1149729358 17:58929305-58929327 TTGACTGGAAAGGAGGAGGATGG + Intronic
1149856011 17:60083524-60083546 TTGGTTAAAGGTGAGGAGGAGGG - Intergenic
1155996380 18:32335002-32335024 GTGGCTATATTTGAGGAGGAAGG - Intronic
1156318749 18:35997684-35997706 TTGACTAAAGATGGGTAAGATGG - Intronic
1157422292 18:47557259-47557281 TTTACTGGCTATGAGGAGGAGGG - Intergenic
1158926182 18:62263884-62263906 GTAATTAAATATGAGGAGAAAGG + Intronic
1158939784 18:62396779-62396801 TTGACTACAAAGGAGCAGGAAGG - Intergenic
1160143822 18:76348285-76348307 TTGACTCAACGTGGGGAGGATGG - Intergenic
1164757177 19:30698679-30698701 TTGACTTGATATGATGAGAATGG - Intronic
1165084142 19:33331193-33331215 TTGACTAAGTATGTGGACAAAGG + Intergenic
926838735 2:17053976-17053998 TTGACAAAATTCAAGGAGGATGG + Intergenic
928497139 2:31844916-31844938 GTGAATAGATATGAGGAAGATGG - Intergenic
928745477 2:34408765-34408787 TTGACTAAATAAAAGCAGAATGG - Intergenic
930992248 2:57670740-57670762 TTGACTAGAGAAGAGCAGGAGGG - Intergenic
933394857 2:81718205-81718227 TTGATAAAATGAGAGGAGGATGG + Intergenic
934694123 2:96386311-96386333 TTGCCTATGTATGAGGAGAAGGG - Intergenic
938816004 2:134904765-134904787 TGGACTAAATGTGAGGAAGAGGG + Intergenic
939328924 2:140733196-140733218 TTGACTAAATTTAAGTTGGAGGG - Intronic
939701456 2:145397563-145397585 ATGATGAAATATTAGGAGGATGG + Intergenic
939773641 2:146357328-146357350 TTGACCAAATATGATGCAGAAGG - Intergenic
940522974 2:154775258-154775280 TTCACTAAATATTATGAAGAAGG - Intronic
941774079 2:169372879-169372901 TTGATTTAATATGAGGAGAATGG - Intergenic
943184702 2:184592815-184592837 TTAAGTAAAGATGGGGAGGAGGG - Intergenic
943309144 2:186305002-186305024 TATACTAAAAATGAGGAGGTAGG - Intergenic
949011952 2:241685704-241685726 TTCACTGAATCTCAGGAGGAAGG + Intronic
1169510013 20:6253638-6253660 ATTACTAAAAATGAGGAGGCAGG + Intergenic
1169812495 20:9622474-9622496 TGAAGTAAACATGAGGAGGAGGG + Intronic
1169955445 20:11097760-11097782 TTGACAGAAGATGAGGTGGAAGG - Intergenic
1170579928 20:17691062-17691084 TTTCCTAAATGTGAGCAGGATGG - Intergenic
1170910292 20:20559711-20559733 ATGAGGAAATAGGAGGAGGAGGG + Intronic
1170930484 20:20765817-20765839 TTGACTAAATTTCTGGAGAAAGG + Intergenic
1171241462 20:23570362-23570384 TTAAATAAATATGAGAAGAATGG - Intergenic
1172921021 20:38482389-38482411 GTGACTAAAGATTAGAAGGATGG - Intronic
1173450441 20:43158995-43159017 TTGACTTAAGATGAGGATAAGGG + Intronic
1177607073 21:23394320-23394342 TGAACTAAAGATGAAGAGGATGG + Intergenic
1178202510 21:30423435-30423457 TTGAGTAAATATTATGAGCATGG + Intronic
1178633852 21:34285450-34285472 TTAACTAACTATGAGAAGCAAGG + Intergenic
1179360942 21:40708192-40708214 TAGACAAAATATAAGGAGGCTGG + Intronic
1180734190 22:18003380-18003402 TTGTCTGATTATGAGAAGGAAGG - Intronic
1182837218 22:33352141-33352163 CTGACACAATGTGAGGAGGAGGG + Intronic
1183251196 22:36731687-36731709 TGGACTGAGCATGAGGAGGATGG - Intergenic
1184985287 22:48128580-48128602 TTGATCAAATATGTGTAGGATGG - Intergenic
949782247 3:7702775-7702797 TTGAATAATTAGGAAGAGGATGG + Intronic
950725006 3:14911552-14911574 TTGACGAAGTATGAGGAAGCTGG - Intronic
950925900 3:16741659-16741681 TTGACTGAAAATGAGGAGGGAGG + Intergenic
951029588 3:17866746-17866768 CTGAGTAAATATGATGAGAAGGG - Intronic
952044260 3:29299051-29299073 TTGACTTAAATTGAGGAGAAAGG + Intronic
952710658 3:36429102-36429124 TGGACTGAATGTGAAGAGGAAGG + Intronic
960934453 3:122889017-122889039 TTGACAAAAGAGGAGGAGGGAGG - Intergenic
961675981 3:128567038-128567060 TTCAATAAAAAAGAGGAGGAAGG + Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963341972 3:144047137-144047159 TTGAGTAAAAAGGAGGAGGGAGG - Intronic
963449234 3:145456889-145456911 TTGACTGGATATGGGGAAGAGGG - Intergenic
964653733 3:159043196-159043218 TAGAACAAATATGTGGAGGAAGG - Intronic
964817098 3:160728868-160728890 TTGACCAAATGAGGGGAGGAAGG + Intergenic
964927074 3:161972711-161972733 GTGACTAATTATTAGGAAGAGGG + Intergenic
965253489 3:166372536-166372558 TTGACTAAATATTCAGAGGTTGG - Intergenic
967027993 3:185581268-185581290 TTTATTAGATATGAGAAGGAAGG + Intergenic
967763632 3:193252862-193252884 TTGTCTAAAAATGAGGAGATTGG + Intronic
969148895 4:5151357-5151379 TTCATTCAATATTAGGAGGATGG - Intronic
971156947 4:24093429-24093451 TTTACTAGAGATGAGGTGGAAGG - Intergenic
973729744 4:53811592-53811614 TGGACAAAATATGGAGAGGAAGG + Intronic
973927752 4:55757044-55757066 TTGGCTAAATGAAAGGAGGAGGG - Intergenic
974265060 4:59576422-59576444 TTGATTAAATATTAGGAATAAGG + Intergenic
974748606 4:66107330-66107352 TTGACTAATTATTAGAAGGCGGG - Intergenic
976382909 4:84420455-84420477 TTGACCACATGTGAGGAAGAGGG + Intergenic
976839377 4:89413652-89413674 ATGACCACATAGGAGGAGGAGGG - Intergenic
978305626 4:107324941-107324963 TTTCCTAAAGATGAGGGGGAAGG + Intergenic
979553296 4:122015848-122015870 TTCACTTAATATGAGTAGTATGG + Intergenic
982282064 4:153693702-153693724 CACACTAAAGATGAGGAGGAAGG - Intergenic
985711061 5:1430245-1430267 GTGACGAACTCTGAGGAGGACGG - Intronic
986884730 5:12219231-12219253 TTTACTAAAAATGAGGAAGGAGG - Intergenic
986923829 5:12721134-12721156 TTGACTTTATAGGAAGAGGAAGG + Intergenic
987518275 5:18944239-18944261 TTGATTAGATATGAGAATGAGGG + Intergenic
987749219 5:22018060-22018082 TGGACTAAATATTAAAAGGAAGG - Intronic
989341794 5:40384432-40384454 CTGATTAAATATGAGGAGAAGGG + Intergenic
989685738 5:44084882-44084904 TTGGCAATATATGAGGAGAAAGG - Intergenic
990154323 5:52857503-52857525 TTGGCTAAAAATGAGGGAGATGG - Intronic
991335404 5:65541206-65541228 TTAATTAAACCTGAGGAGGAGGG + Intronic
991360550 5:65815375-65815397 TTGTCTAAATAAGAGTAGTATGG - Intronic
992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG + Intergenic
992701480 5:79345571-79345593 TTGAGTAAATAGGAGTAGAATGG + Intergenic
993408090 5:87537342-87537364 TTTACTAAATAAGAGGAGGAAGG + Intergenic
993676885 5:90826328-90826350 TTGACAAAAAATGAAGAAGATGG - Intronic
995685494 5:114767529-114767551 TGGAGTACAAATGAGGAGGAAGG + Intergenic
995961835 5:117851023-117851045 TTGACAAAGTATGAAGAAGAGGG + Intergenic
996914141 5:128691974-128691996 TTGCCTAAATATGGGGTGAATGG - Intronic
998521469 5:142804834-142804856 TTCACTACAAATGAGCAGGAAGG - Intronic
999851911 5:155549842-155549864 TTTCCAAAATAGGAGGAGGAGGG - Intergenic
1001835093 5:174824955-174824977 TTGATTAGATATGAGAGGGAGGG - Intergenic
1002381890 5:178836849-178836871 TTTACTGAATAAGAAGAGGAAGG - Intergenic
1003857372 6:10290127-10290149 TTGACTAGATGTGAGTAGGTTGG - Intergenic
1007507662 6:42348713-42348735 TTCACTAAGTATGAGCAGAAAGG + Intronic
1010409920 6:75549666-75549688 CTGACTAAATAGGAGTAGAAAGG + Intergenic
1010787869 6:80025980-80026002 TTGTCTACATTTGAGGAGAAGGG + Intronic
1013564101 6:111339914-111339936 TTGACAAAGCATTAGGAGGATGG - Intronic
1014491349 6:122065547-122065569 TTGAATAAATATACGAAGGAAGG + Intergenic
1014703237 6:124715300-124715322 TTGACCACATATTAGGAGAACGG + Intronic
1018875930 6:167822628-167822650 GTGACTAAATATTAGGAACACGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023057983 7:36304910-36304932 TTCAGTAAATATGAGTTGGATGG - Intergenic
1024077120 7:45827120-45827142 TTGACTAAATGTGTGAATGAAGG + Intergenic
1025127298 7:56354301-56354323 TTGACTAAATGTGTGAATGAAGG - Intergenic
1025602549 7:63013872-63013894 TTGACTAAATATGTGAATGAAGG - Intergenic
1026662088 7:72311113-72311135 TAGACTGAAGAGGAGGAGGAGGG - Intronic
1033534866 7:142302885-142302907 TTGACTGAAAATGAGCATGAAGG - Intergenic
1033706842 7:143897281-143897303 TAGGCTAAGGATGAGGAGGAAGG - Intronic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1038355503 8:26825376-26825398 TTGACAAAAAATGGGGAGGGTGG + Intronic
1038699595 8:29837176-29837198 GAGTCTAAGTATGAGGAGGAAGG + Intergenic
1040552810 8:48451476-48451498 CTGACTAAAAATGAGGAGATGGG + Intergenic
1040918122 8:52584849-52584871 TTGAATAAATATAAGGAAGTAGG - Intergenic
1042398185 8:68315173-68315195 ATGAATAAATATGAGGAAGAAGG - Intronic
1042635038 8:70865076-70865098 TTGACCAAATATGAGGAGAGAGG - Intergenic
1045412729 8:101934895-101934917 TTGCCTAAGTCTGAGGAGGATGG - Intronic
1045904988 8:107334039-107334061 ATGGATAAATATGAGAAGGAGGG + Intronic
1047536628 8:125726149-125726171 TTGAATAAACATGAAAAGGAAGG - Intergenic
1047551050 8:125872596-125872618 CTGGCTACATATGAAGAGGAGGG - Intergenic
1047580858 8:126213839-126213861 TTGAATAAAAATGTGGAGGAGGG + Intergenic
1048565306 8:135589785-135589807 CTAAGTAAATATGCGGAGGATGG + Intronic
1048903728 8:139066398-139066420 TAGAATAAATATGAAGGGGATGG + Intergenic
1048941113 8:139401636-139401658 ATTATTAAATATGAGAAGGAGGG + Intergenic
1049281741 8:141753024-141753046 TTGAAGAAATGTGAGGGGGACGG + Intergenic
1050226429 9:3462496-3462518 TTGAGTAAAAATGGGGAGGGAGG - Intronic
1052678758 9:31660942-31660964 GTGACTAAATAAGAGAAGCAAGG - Intergenic
1054549918 9:66390503-66390525 TTGCCTAATCATGAGGAGGCGGG - Intergenic
1055225304 9:73988346-73988368 TTCCCAAAAAATGAGGAGGAAGG + Intergenic
1060164721 9:121401627-121401649 TTCAAAAAATTTGAGGAGGAAGG + Intergenic
1060558203 9:124521069-124521091 TTGACTAAATAGGCAGAAGAAGG + Exonic
1188796243 X:34469272-34469294 TTTACTATATATGGGGAGGGAGG - Intergenic
1190124959 X:47696352-47696374 TTGCCTAAATATGGGGAGATAGG - Intergenic
1190755029 X:53394301-53394323 ATGGGTAAATATGGGGAGGAAGG + Intronic
1190790211 X:53692683-53692705 TGGACAACATATGAGGATGAGGG - Intergenic
1190827614 X:54032035-54032057 TAGACTAAAGGTGAGGAGCAAGG - Intronic
1190924271 X:54887923-54887945 TTCACTAAATAGGATAAGGAGGG + Intergenic
1194567989 X:95517739-95517761 TTTACTAAATAAGGAGAGGAAGG + Intergenic
1194707104 X:97189088-97189110 TTAGCTGAAAATGAGGAGGATGG + Intronic
1195567540 X:106360071-106360093 TTCAAAAAATTTGAGGAGGAGGG - Intergenic
1196361976 X:114872155-114872177 GTGAATAAATGGGAGGAGGAAGG - Intronic
1198300549 X:135330461-135330483 TGCACCAAATATCAGGAGGAAGG + Intronic
1198767525 X:140094280-140094302 CTGAAAAAATATGAGGAGGAGGG + Intergenic
1201384984 Y:13430246-13430268 TTGCAAAAAAATGAGGAGGAGGG - Intronic