ID: 913310994

View in Genome Browser
Species Human (GRCh38)
Location 1:117493115-117493137
Sequence AGGAGAAAACAGAAGGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 993
Summary {0: 1, 1: 0, 2: 8, 3: 85, 4: 899}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913310994_913310997 2 Left 913310994 1:117493115-117493137 CCTCTATCCTTCTGTTTTCTCCT 0: 1
1: 0
2: 8
3: 85
4: 899
Right 913310997 1:117493140-117493162 GTTACAGATCATACATCTGTCGG 0: 1
1: 0
2: 0
3: 15
4: 131
913310994_913310998 5 Left 913310994 1:117493115-117493137 CCTCTATCCTTCTGTTTTCTCCT 0: 1
1: 0
2: 8
3: 85
4: 899
Right 913310998 1:117493143-117493165 ACAGATCATACATCTGTCGGTGG 0: 1
1: 0
2: 1
3: 3
4: 70
913310994_913311000 11 Left 913310994 1:117493115-117493137 CCTCTATCCTTCTGTTTTCTCCT 0: 1
1: 0
2: 8
3: 85
4: 899
Right 913311000 1:117493149-117493171 CATACATCTGTCGGTGGCCTGGG 0: 1
1: 0
2: 1
3: 3
4: 73
913310994_913310999 10 Left 913310994 1:117493115-117493137 CCTCTATCCTTCTGTTTTCTCCT 0: 1
1: 0
2: 8
3: 85
4: 899
Right 913310999 1:117493148-117493170 TCATACATCTGTCGGTGGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913310994 Original CRISPR AGGAGAAAACAGAAGGATAG AGG (reversed) Intronic
900712012 1:4120298-4120320 AAGAGAAAACAGACACATAGGGG - Intergenic
900943081 1:5813751-5813773 AGGAGAACAGAGAAGGAAGGAGG + Intergenic
901221159 1:7584620-7584642 AGCAGAGAACAGAAGAACAGGGG + Intronic
901228207 1:7626841-7626863 AGGAGTAAACAGAAGGGTTTAGG + Intronic
902546640 1:17194453-17194475 AGGGAAAAACTGAAGGACAGAGG - Intergenic
903139798 1:21332646-21332668 GGGAGGAAACAGGAGGAGAGCGG + Intronic
904489449 1:30849422-30849444 AGGAGAAAACAGATTCAGAGAGG + Intergenic
904797833 1:33070672-33070694 AGGAGAAAGAAGAAGAAGAGAGG + Intronic
905166671 1:36087177-36087199 AGGAGAAAACACAGGGCAAGGGG - Intronic
905466129 1:38155011-38155033 AGGAGAAAAAAGAGGAAGAGAGG - Intergenic
905752770 1:40479994-40480016 AGGAGTAAATAGAAGGATGGAGG + Intronic
905768916 1:40624956-40624978 GGGAGAAAGCAGCAGGACAGTGG - Exonic
905921380 1:41721714-41721736 AGGAGGAAACTGAGGCATAGAGG + Intronic
906651387 1:47515489-47515511 AGGAGAAAAGGGAAGGATGGTGG + Intergenic
906667187 1:47630315-47630337 GGGGGAAAACAGGAGCATAGTGG + Intergenic
906960429 1:50416522-50416544 AGGAGAAAAAAGAGGGCGAGAGG - Intergenic
907650467 1:56289819-56289841 AGGAGAAAATGGAAGCACAGTGG - Intergenic
907775067 1:57506195-57506217 AGAAGAAAAAAGGAGGAAAGGGG + Intronic
908252976 1:62279840-62279862 AGAAGAAAAAAGAAAGCTAGAGG + Intronic
908516068 1:64894088-64894110 AGGGAAAGACAGAAGGACAGAGG + Intronic
908781648 1:67696244-67696266 CCCAGAAAACACAAGGATAGTGG - Intergenic
908954270 1:69602198-69602220 TGGAGAAAACAGAAAGATTCTGG - Intronic
909285868 1:73816333-73816355 AGGGGATAACAGAAAAATAGGGG + Intergenic
909291099 1:73884814-73884836 AGGAGAAAGAAGAAGTATATGGG + Intergenic
909555645 1:76950705-76950727 AGGAGGAAAGACAAGGGTAGAGG + Intronic
910021928 1:82602117-82602139 AGGAAAGAAAAGAAGGAAAGAGG - Intergenic
910425862 1:87119675-87119697 AGGGGAAAACAGAAATATTGTGG + Intronic
910473051 1:87576105-87576127 AGAGGAAAAGAGAAGGAGAGAGG - Intergenic
910574967 1:88751132-88751154 AAAAGAAAACATAGGGATAGGGG - Intronic
910794779 1:91086895-91086917 AGGAAAAAAAAGGAGGAGAGAGG + Intergenic
910857522 1:91710623-91710645 AGCAGCAAACAGAAAGACAGTGG + Intronic
911105903 1:94131308-94131330 TGGAGAAAACAGAAGGAAAATGG + Intergenic
911382324 1:97130653-97130675 AGGAAAAAAGAAAAGGATAGAGG - Intronic
911690518 1:100828672-100828694 AGGAGAAAAAAGAAAGGAAGAGG - Intergenic
911808506 1:102243098-102243120 AGGAGAAAACAGAAGGGTTGGGG + Intergenic
911879666 1:103220309-103220331 AGGAAAAAAGAGATGGATGGAGG + Intergenic
911993108 1:104727617-104727639 AACAAAAAACAGAAGGAAAGTGG + Intergenic
912306206 1:108570223-108570245 AGGAGAAAACAGAATGATAAAGG + Intronic
913134854 1:115878314-115878336 ATGAGAAAACAGAGGCACAGGGG + Intergenic
913176739 1:116279686-116279708 AGGAGGAAACAGAGGCATAGAGG - Intergenic
913177650 1:116289610-116289632 GGGAGAAAACAGAGATATAGAGG + Intergenic
913310994 1:117493115-117493137 AGGAGAAAACAGAAGGATAGAGG - Intronic
913312465 1:117514908-117514930 AGCAGAAAACAGCAGAATAGGGG - Intronic
913403677 1:118464070-118464092 AGGAGAAGACAGGAAGAGAGGGG - Intergenic
914334737 1:146704213-146704235 AGGAGAGAAGAGAGGGATAGAGG + Intergenic
914567734 1:148885451-148885473 AGCAGAGAACAGAGGGAGAGTGG + Intronic
914605089 1:149244794-149244816 AGCAGAGAACAGAGGGAGAGTGG - Intergenic
914696544 1:150087512-150087534 AGGAGAAAAAAGAATCAGAGAGG - Intronic
914854864 1:151343479-151343501 AGGAGGAAACTGAGGAATAGGGG + Intronic
915102811 1:153512979-153513001 AGGAAAGTACAGAAGGAAAGGGG + Intergenic
915267364 1:154728636-154728658 AGGAGAAAAGAGAAGAGAAGAGG + Intronic
915376378 1:155399858-155399880 AGGAGAAAAGTGTAGGATGGAGG + Intronic
915948731 1:160173513-160173535 AGGAGAAAAATGAAGGATCCGGG + Intronic
915974453 1:160375737-160375759 AGAAGAAAGCAGAAAGATAAAGG - Intergenic
916149333 1:161771129-161771151 AAGAGAAGAGAGAAGGAGAGAGG - Intronic
916208473 1:162338331-162338353 AGGAGAAAAGAGAATAATGGGGG - Intronic
916936663 1:169634834-169634856 AGGAGAAAATAGAGGAAAAGGGG + Intergenic
917307272 1:173639474-173639496 AAGAGAACACAGAAGGAAAATGG + Intronic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
917697810 1:177545643-177545665 AGGAGGAAAAAGAGGGATAGAGG - Intergenic
917941674 1:179928324-179928346 AGGAGGAAAAGGAAGGAGAGGGG - Intergenic
918194357 1:182207625-182207647 AGGAGAAAACAGGAGGGTGCGGG - Intergenic
918375902 1:183908838-183908860 GGGAGAAGGCAGGAGGATAGAGG - Intronic
918430489 1:184454935-184454957 AAGAGAAAAGAGAAAGAAAGAGG + Intronic
918497509 1:185156885-185156907 AGTAGAAAACAGAAAGCCAGAGG + Exonic
918596754 1:186303297-186303319 AGGAGAAACAAGAGGGACAGTGG + Intronic
918881094 1:190122439-190122461 AGGAGATTACAGAAACATAGAGG + Intronic
919463613 1:197907525-197907547 ATGAGAAAACAGTAGGAGAACGG - Intergenic
919516490 1:198531970-198531992 AGGAGAAAAAAAAAGGCAAGGGG + Intronic
919697268 1:200590596-200590618 AGTATAAAAAAGAAGGTTAGTGG + Intronic
919888786 1:201955140-201955162 AGGAGAGAAGAAAAGGAAAGGGG + Intergenic
919908109 1:202092243-202092265 GGGACAAAACAGAAGCATTGTGG - Intergenic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
921850343 1:219927558-219927580 AGGAGAAAAAAGAAGGGATGGGG + Intronic
922022981 1:221722767-221722789 AGCAGGAAACAGAAGAGTAGTGG + Intronic
922383191 1:225054126-225054148 AGTAGGAGACAGAAGGAGAGAGG - Intronic
922594031 1:226799818-226799840 AGGAGAAAATAGAGTCATAGAGG + Intergenic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
922964987 1:229682039-229682061 AAGAGAAGAAAGAAGGAGAGAGG - Intergenic
923051329 1:230393116-230393138 AGGGGAAAAAAGAAGGGTAGGGG + Intronic
923120282 1:230983750-230983772 TGGAGAACACAGCAGGACAGAGG + Intronic
924012841 1:239684881-239684903 AGGGGAAAAGATAAGAATAGGGG + Intronic
924251436 1:242137065-242137087 AGGGGAAAACAGAAAGAAAAAGG + Intronic
924526536 1:244856494-244856516 AGAAGAAAGCAGAAGTAGAGGGG - Exonic
924830420 1:247588496-247588518 ACGAGAAACCAGAATGATGGTGG - Exonic
1063557823 10:7097312-7097334 AAGAGAAAGCAGAATGTTAGCGG - Intergenic
1063676877 10:8148361-8148383 GGGAGAAAACAGAAAGCCAGAGG - Intergenic
1063985926 10:11501804-11501826 AGGAGAGAAAAGAAGGAGAAAGG - Intronic
1064074098 10:12255163-12255185 AGGAGAAAACAGAGGGAGGGTGG - Intergenic
1064265694 10:13823414-13823436 AGGAGAAAACAGAAAAAGACAGG + Intronic
1064497380 10:15926781-15926803 AGTAGAAAAGAGAAGGAAAAAGG - Intergenic
1064620891 10:17216288-17216310 AAAAGAAAACAGAAGCATAATGG + Intergenic
1065371589 10:24992283-24992305 AGTAAAATAAAGAAGGATAGTGG + Intronic
1065853634 10:29812512-29812534 AGGAGAAAAGAGACAGATACAGG - Intergenic
1066240678 10:33531627-33531649 AGGAAAAGACAGAAAGAAAGGGG + Intergenic
1067688233 10:48480767-48480789 ATGAGAAAACTGAAGCACAGAGG + Intronic
1067916378 10:50403898-50403920 AGGAAATAAAAGAAGGGTAGGGG - Intronic
1067973893 10:51002142-51002164 AGGAGAAAACAGAGAAATAATGG + Intronic
1068073238 10:52222251-52222273 AGCAGCAAACAGCAGGAGAGGGG - Intronic
1068311040 10:55275013-55275035 AAGAGAAAACAGCAGGAAATGGG - Intronic
1068478972 10:57564452-57564474 TGGAGAAAACTGAATCATAGGGG + Intergenic
1068803209 10:61164783-61164805 AGGAAAAAGCAGCAGGATTGCGG - Intergenic
1069725703 10:70576491-70576513 AGGAGGAAACAGAAGGCAACAGG - Intergenic
1070013570 10:72501638-72501660 AGGAGAAAAAATAAAGAAAGAGG + Intronic
1070554747 10:77518845-77518867 TGGAGAAAACCCAAAGATAGTGG + Intronic
1070759753 10:79016691-79016713 AGGAGAGACCAGAAGGAAGGAGG + Intergenic
1071137643 10:82470359-82470381 AGGAGAAAATTGAAGCCTAGAGG - Intronic
1071558416 10:86625300-86625322 AGGATAAAGAAGAAGGAAAGAGG + Intergenic
1071681620 10:87711805-87711827 AGAAGACAACAGGAGGAAAGAGG - Intronic
1071956029 10:90760303-90760325 AGGAGTAAAAAGGAGGACAGAGG + Intronic
1072532459 10:96332182-96332204 AGGAGAAAACACTAAGAAAGTGG - Intronic
1072541976 10:96405525-96405547 GGGAGTAAACAGAAGGAGATGGG + Intronic
1072940739 10:99761332-99761354 AGAAGAAAACAGGAAGATAAGGG - Intergenic
1073577601 10:104639444-104639466 AGGAGAAAATAGAGGGAAAAGGG - Intergenic
1074080570 10:110165202-110165224 ATGAGAAAACAGAGGCACAGAGG - Intergenic
1074914498 10:117942310-117942332 AGATGAGAAAAGAAGGATAGAGG - Intergenic
1075284457 10:121171707-121171729 AGGAAAAAAGAGAAAGAAAGAGG + Intergenic
1075399953 10:122153768-122153790 ATGAGAAAACGGAAGCACAGAGG + Intronic
1076282911 10:129264864-129264886 AGGTGAAAACAGGATGATGGAGG + Intergenic
1076437911 10:130459283-130459305 AGGTGAAAAGGGAAGGGTAGAGG + Intergenic
1076563891 10:131385575-131385597 AGGAGCAGAGAGAGGGATAGAGG + Intergenic
1076565778 10:131398125-131398147 AGCAGAAAACAGAGGCAAAGTGG - Intergenic
1076611960 10:131731754-131731776 AGGAGAAAGCAGAGGGTTTGGGG - Intergenic
1076802537 10:132837262-132837284 TGGAGGACACAGAAGGATGGAGG - Intronic
1076984199 11:223617-223639 AGGAGAAGGGAGAAGGATGGGGG - Intronic
1077772517 11:5235519-5235541 AGGAGAAAAAAGGAGGGGAGAGG + Intergenic
1077827181 11:5823785-5823807 AGGAAAAAACAGAGGGAGACAGG - Intronic
1077857245 11:6140665-6140687 AGTAGAAAACAGAAAAATAAAGG + Intergenic
1077921032 11:6641736-6641758 GGGAGAAAACAGAAGGAAACGGG + Intronic
1078587152 11:12601675-12601697 AAGAGAAAAGAGATGGAAAGAGG - Intergenic
1078949819 11:16117596-16117618 AGGGGAAAAGACAAGGAAAGAGG + Intronic
1079530932 11:21452113-21452135 AAAAGAAAAGAGAAGGAGAGAGG + Intronic
1080732855 11:34978515-34978537 AGGAGAAAAAGAAAGGATAAGGG + Intronic
1081480438 11:43482147-43482169 AAGAGAAAACAAAAAGATGGTGG - Intronic
1081597943 11:44472159-44472181 ACGAGCAAACTGAAGCATAGAGG + Intergenic
1081761498 11:45579592-45579614 AGGAGAAGAAGGAAGGATACAGG - Intergenic
1082223924 11:49677769-49677791 AGGAGAAAAGAGAAGAGAAGAGG - Intergenic
1083385382 11:62305531-62305553 AGGAAAAAACAGAAGGTTAGAGG - Intergenic
1085063802 11:73473549-73473571 TGAAGAAAACAAAAAGATAGTGG - Intronic
1085080738 11:73632113-73632135 AAGAGCAAACAGAAGGTTGGAGG + Intergenic
1085794977 11:79530960-79530982 AGGTGAAAAGAGAAGGAAACTGG - Intergenic
1086541920 11:87922975-87922997 AGGAGAAAATAAAAGAATAGGGG + Intergenic
1087273409 11:96136211-96136233 AGGAGAAAACTGATGGTAAGTGG - Intronic
1087382404 11:97423322-97423344 AGGAGATCACAGCTGGATAGAGG + Intergenic
1087431562 11:98062795-98062817 AGGAGAGAGGAGAAGGAAAGGGG + Intergenic
1087507242 11:99041271-99041293 GGCAAAAATCAGAAGGATAGAGG - Intronic
1087623128 11:100565169-100565191 AGGAGAAATAACAAGGAAAGAGG - Intergenic
1089014707 11:115156574-115156596 AGGGGAAGACAGAAGGAGGGAGG - Intergenic
1089428179 11:118398195-118398217 AGGAGAAAACTGGAGGAAAATGG + Exonic
1089644671 11:119870898-119870920 AGGAGAATAAAGAAGGATAAGGG + Intergenic
1089929578 11:122296875-122296897 AGGAGAAGACAGAACGGTGGAGG + Intergenic
1090077449 11:123588192-123588214 AGGAGAAAACAGATGGATTTCGG - Intronic
1090519101 11:127459709-127459731 AGGAGAAGACATAAGTAAAGAGG - Intergenic
1090592507 11:128287586-128287608 GGGAGAAAAAGGAAGGAAAGTGG - Intergenic
1090785943 11:130047447-130047469 TGGAGAAAACAAAATGATAAAGG + Intergenic
1090861926 11:130661686-130661708 TGGAGAAACAAGAAGGCTAGAGG + Intergenic
1091010024 11:131992550-131992572 ATGAGAAAACAGCAGAATTGAGG - Intronic
1091242170 11:134060580-134060602 AGGAGAAAGCAAAGAGATAGAGG - Intergenic
1091616943 12:2056729-2056751 TGGAGAAAACTGGAGGAAAGGGG + Intronic
1091964043 12:4723009-4723031 AGGAGAGAATAAAAGGAGAGAGG + Intronic
1092306046 12:7302187-7302209 GGGAGAAAAGAGAAGCAGAGTGG - Intergenic
1092367972 12:7892769-7892791 AAGAGAAAAGGGAAGGAGAGAGG + Intergenic
1092558449 12:9582638-9582660 ATGAGGAAACTGAAGCATAGAGG + Intergenic
1092629343 12:10361671-10361693 AAGAGCAAAGAGAAGGTTAGAGG + Intergenic
1092776667 12:11949864-11949886 AGGAGAAACCAGAAGCAGGGAGG + Intergenic
1093331478 12:17848340-17848362 ATGAGAAAACAGAAGGCTAGAGG + Intergenic
1093612031 12:21172625-21172647 AAGAAAAATCAGAAGGAAAGGGG - Intronic
1093659837 12:21743309-21743331 AGGAGAAAATAGAAAAAAAGGGG - Intronic
1094014690 12:25849903-25849925 AGGAGAAAACAGTAGCCCAGAGG + Intergenic
1094121381 12:26978295-26978317 ATGAGAAAACAGAAATAAAGAGG - Intronic
1094213056 12:27912846-27912868 AGGAGAAAAAAGAGAGATGGAGG + Intergenic
1094404640 12:30103668-30103690 AACAGAAAACAGAAAAATAGAGG - Intergenic
1094765737 12:33592546-33592568 AGGAGAACAGAGAAGGAAATGGG + Intergenic
1095135430 12:38595526-38595548 AAGAGTAAACAAAAGGATTGAGG - Intergenic
1095242496 12:39877989-39878011 AGGAGCAAGCAGTAGGAGAGTGG - Intronic
1095308998 12:40673379-40673401 AGGTGAAAAAAGAAGGATATTGG + Intergenic
1095873453 12:47055392-47055414 AGGAGAACAAAGAAGGGTGGTGG - Intergenic
1096231626 12:49900085-49900107 AGGGGAAAAGAGAGGGAAAGTGG + Intronic
1096504471 12:52083917-52083939 AGGAGAGAAGAGAAGAAGAGAGG + Intergenic
1096539339 12:52296248-52296270 AGGAGGAAACTGGAGGACAGTGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096581240 12:52586848-52586870 AAGAGAAATCAGAATGACAGAGG - Intronic
1097006832 12:55925907-55925929 GGTAGAGAACAGAAGGAAAGAGG + Intronic
1097257629 12:57692374-57692396 AGGAGAAAACATAAAAATAAAGG - Intergenic
1097905588 12:64915809-64915831 ATCAGAAAAGAGAATGATAGAGG - Intergenic
1097930710 12:65182045-65182067 GTGAGAAAACGGAAAGATAGAGG + Intronic
1098049900 12:66442472-66442494 AGGAAAATACAGCAGCATAGAGG - Intronic
1098249763 12:68557229-68557251 GGGAGATAAGAGAAGGAGAGAGG - Intergenic
1098763277 12:74452214-74452236 AGGTGAAAAAAGAAGAAAAGTGG + Intergenic
1098871824 12:75825318-75825340 AGGAGACAGCAGAAAGATTGAGG - Intergenic
1099060984 12:77908468-77908490 AGGAGAAAAAACAATGATACAGG + Intronic
1099065197 12:77968304-77968326 GGGAGAGAATAAAAGGATAGAGG - Intronic
1099072509 12:78063765-78063787 GGGAGAAATCAGAAGGAATGTGG + Intronic
1099536205 12:83848179-83848201 AGGAGAAGACAGAAGTAGGGAGG - Intergenic
1100083975 12:90885087-90885109 AGGAGAAACCTGAAGCATAAAGG - Intergenic
1100242809 12:92726768-92726790 AGGAGAAAGGAGAAGGGCAGAGG + Intronic
1100782753 12:98046950-98046972 AGGGGAAAAGAGAAGGAAAGCGG - Intergenic
1100848460 12:98684463-98684485 AGGAGGAGACAGAAGAAGAGAGG - Intronic
1101250131 12:102925214-102925236 AGGAGAAAATAAAAGGAGAAGGG - Intronic
1101304764 12:103517144-103517166 AGGATAAAACACAGGGAAAGAGG + Intergenic
1101465713 12:104946923-104946945 ATGAGAAAACTGAGGTATAGAGG - Intronic
1101540991 12:105665330-105665352 AAGAGAAAACTGAAGCAGAGAGG + Intergenic
1101550805 12:105759827-105759849 AGGAGAAAAGAAAGTGATAGGGG + Intergenic
1101745627 12:107539283-107539305 AGAAGAAAACTCAAAGATAGAGG - Intronic
1101823193 12:108199975-108199997 AGGAGAAAATGGAGGAATAGAGG + Intronic
1101906246 12:108828654-108828676 AGTAGAAATCAGAAGGGCAGGGG + Intronic
1102008563 12:109604228-109604250 AGGAGAAAACCAAATGAAAGAGG + Intergenic
1102902231 12:116647364-116647386 AAGAGAGAACAGAAGGGAAGAGG - Intergenic
1102906519 12:116680014-116680036 AGAAGAAAACAGGAGGCTGGGGG - Intergenic
1103012276 12:117466454-117466476 AGGAGAAAACAGCAGAAATGGGG + Exonic
1103295620 12:119884059-119884081 AGGAAAAGAGAGAAGGAGAGAGG + Intergenic
1103424794 12:120823786-120823808 ATGAAAAAACAGAAACATAGTGG + Intronic
1103677246 12:122665551-122665573 AAGAGAAAAGAGAAGAAAAGAGG - Intergenic
1104036758 12:125102963-125102985 AGGAGAAAACACAAGGTTACAGG - Intronic
1104441145 12:128794358-128794380 TGGAGAAAACAAAAGGAAAGCGG + Intronic
1104557469 12:129814222-129814244 AGGAGAAAAAAGAATGAAACTGG + Intronic
1105438995 13:20400284-20400306 GAGAGAAAACAGAAGGGCAGAGG - Intergenic
1105444366 13:20439931-20439953 AGGAGAGAGCAGAAGGGCAGAGG - Intronic
1105936820 13:25108003-25108025 AGGAGAAAACATAAGTCTAGTGG + Intergenic
1106646782 13:31643556-31643578 CAGAGAAAACAGAAGTATATAGG + Intergenic
1106782217 13:33070389-33070411 GGGAGGAAAGCGAAGGATAGAGG + Intergenic
1107130525 13:36889467-36889489 ATGAGAAAACAGAAGCAAAATGG + Intronic
1107609083 13:42094901-42094923 AGCAGAAAACAAATGGGTAGTGG + Intronic
1108145879 13:47476441-47476463 TGGAGAAAACAAAATGATATAGG - Intergenic
1108304040 13:49113101-49113123 AGGAGAAAACAGAAGGGTAAGGG - Intronic
1108444073 13:50488755-50488777 AGCAGAGAATAGAAGGATAGTGG - Intronic
1109003441 13:56836215-56836237 AGAAGAAGACAGAAAGATAAAGG - Intergenic
1109162944 13:58999000-58999022 AGGAAAAGAGAGAAGGAGAGAGG + Intergenic
1109516918 13:63455879-63455901 AGAAGAAAATAGGAGGATAGAGG - Intergenic
1109620884 13:64903064-64903086 AGGGGAAAACATAAGGAAAAAGG + Intergenic
1109678240 13:65709596-65709618 ATGAGGAAACAGAAGCACAGAGG - Intergenic
1109700516 13:66018886-66018908 AGGAGAAAAGAGGAGCATATTGG - Intergenic
1110298656 13:73899321-73899343 AGGTGGAAACAGACGGATATGGG - Intronic
1110386958 13:74923704-74923726 AGGAGAAAGGAGAAAGAAAGAGG + Intergenic
1110747161 13:79067716-79067738 AGAAGAAAACAGAGAGACAGAGG + Intergenic
1110804566 13:79739097-79739119 AGTAGAAAAAAGTAGGAAAGTGG - Intergenic
1111363975 13:87216320-87216342 AAGAGAATAAAGAAGGAAAGAGG - Intergenic
1111461951 13:88556685-88556707 AGGAAAAATCAGAAGGAAAGAGG + Intergenic
1111743317 13:92232634-92232656 AAGTTAAATCAGAAGGATAGAGG + Intronic
1111874377 13:93874847-93874869 AGGAGAAAATAAAATGGTAGAGG - Intronic
1111895524 13:94137015-94137037 AGGAGAAAAGACAAGAATAATGG + Intronic
1112104316 13:96223997-96224019 AGGAGAGAAGAGGAGGAAAGGGG - Intronic
1112554248 13:100452154-100452176 AAGAAAAAAGAGAAGGAGAGAGG - Intronic
1112627770 13:101125657-101125679 AGGAGAAAACACAAGATCAGAGG + Intronic
1112742323 13:102489093-102489115 TGCAGACAACAGATGGATAGGGG + Intergenic
1112843920 13:103614392-103614414 AAGAGAAAAAAGAAACATAGGGG + Intergenic
1113154778 13:107307316-107307338 ATGAGAGAACAGAGGGAAAGAGG + Intronic
1113232455 13:108228848-108228870 ATGAGAAAACAGAAGCTCAGGGG - Intronic
1113990426 14:16023896-16023918 AGGAGAGAACAGAGGGAGGGAGG - Intergenic
1114853900 14:26414418-26414440 AGGAGAAAATAGAAGCATAGAGG - Intergenic
1115409204 14:33053284-33053306 AGGAGGAAAGAGATGGTTAGAGG - Intronic
1116602775 14:46948453-46948475 GGGAGAAAACTGAAGAGTAGAGG - Intronic
1116621303 14:47207291-47207313 AGGAGAAAAAATAAGCAGAGGGG + Intronic
1117629426 14:57674481-57674503 AGGAGAATACAGAAGTAAACTGG + Intronic
1117977369 14:61311504-61311526 AGAAGAAAACAGGAAGATATGGG - Intronic
1119113770 14:71999414-71999436 AGGAGAAATCAGAAGTATGATGG + Intronic
1119332533 14:73805653-73805675 ATGAGAAAACTGAAGGACAGAGG + Intergenic
1119626054 14:76177000-76177022 AAGAGAATATAGGAGGATAGAGG - Intronic
1119654242 14:76405600-76405622 AGGAAAAGACAGAAGGAAAATGG + Intronic
1119678464 14:76574140-76574162 AGCAGAAAGGAGAAGGAGAGAGG + Intergenic
1120013962 14:79449225-79449247 AGCAGAAAAGACAAGTATAGTGG - Intronic
1120027931 14:79606871-79606893 AGGAGAAAACAGTAAGGAAGGGG + Intronic
1120342846 14:83244385-83244407 AGGAGAGGACAGAAAGATAAGGG + Intergenic
1120469293 14:84902713-84902735 AGGAGAAAACAGAAAGACGTGGG + Intergenic
1120554981 14:85918632-85918654 AAGAGAAAGCGGAAGGATGGAGG + Intergenic
1121032758 14:90673430-90673452 AAGAGAAAAAAGAAGGAGCGCGG + Intronic
1122765611 14:104067496-104067518 AGAAGAAAACAGAAAGATGAGGG - Intergenic
1123966405 15:25463999-25464021 AGGAGAAAAGAGAATGAGACGGG + Intergenic
1124388279 15:29227657-29227679 AGGAGAAGACGGAAGGAAAGAGG + Intronic
1125129680 15:36268909-36268931 AGGGAAAAACAGAAAGAAAGTGG + Intergenic
1125690165 15:41589656-41589678 AAGAGAATTCAGAAGGAAAGTGG + Intergenic
1125878755 15:43173674-43173696 TGGAGAAAACAGTATGATAAAGG - Intronic
1125982088 15:44011668-44011690 AGGAGGAAAGAGAAGGGTAAAGG + Intronic
1126811458 15:52409934-52409956 AGGAGAAGAAGGAAGGAAAGAGG + Intronic
1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG + Intergenic
1128095692 15:64953062-64953084 AGAAGAAGAAAGAAGGAAAGAGG - Intronic
1128095773 15:64954072-64954094 AGGAGAAAGAAGAAGAAAAGAGG - Intronic
1128659866 15:69490976-69490998 CGGAGAAAACAAAAGAATAAGGG + Intergenic
1128809561 15:70561051-70561073 GGAAGAGAACAGAAGGAGAGTGG - Intergenic
1129515460 15:76154488-76154510 AGCAGAAAACAGGAGGAGAATGG - Intronic
1130306087 15:82712956-82712978 AGGAGAAAAAGGAAGGATCAGGG - Intergenic
1130611327 15:85363926-85363948 AGGAAATCACTGAAGGATAGGGG + Intergenic
1130862164 15:87900814-87900836 ATGAGAACACAGAAGGCCAGGGG - Intronic
1131026437 15:89145904-89145926 AGGAGTACACAGAAGGACACTGG - Intronic
1131039570 15:89250992-89251014 AGTAGAGAACAGAAAAATAGTGG + Intronic
1131080380 15:89529521-89529543 AGGAGGAAACAAAATTATAGTGG + Intergenic
1131357607 15:91758991-91759013 AGGAGAAAATAGAAGCATGAGGG + Intergenic
1131571017 15:93536103-93536125 AGGAGAAAGCAGGAAGGTAGAGG - Intergenic
1131715079 15:95100592-95100614 AGGAGAGAAGAGAAAGAAAGGGG + Intergenic
1131917773 15:97289446-97289468 AGGAGAAAACAGGCGGAAACTGG - Intergenic
1131987667 15:98061386-98061408 AGAAGAAGACAGAAGGATGAGGG - Intergenic
1133523663 16:6582932-6582954 AGGAGAAAAGAGGAGGGGAGGGG - Intronic
1133850046 16:9494855-9494877 AAGAGACAAAAGAAGGAGAGTGG + Intergenic
1133869914 16:9676751-9676773 AGCAAAAAACAGGAGGACAGGGG + Exonic
1133954831 16:10433170-10433192 AGGAAAAAAGAGAAGGAAATAGG - Intronic
1134884087 16:17774484-17774506 ATGAGAAAACAGAGGCACAGCGG - Intergenic
1135290222 16:21230008-21230030 AGAAGAAAAGAGAAGTTTAGAGG - Intergenic
1135988534 16:27202585-27202607 AGGAGATAACTGAATGATAGGGG + Intergenic
1137302196 16:47162275-47162297 AGGATGAAAAAGCAGGATAGAGG + Intronic
1137877907 16:52014823-52014845 AGGAGAGAAGAGAAGCAGAGGGG - Intronic
1138835553 16:60430194-60430216 AGGAGAAAAGAGAGAGAGAGAGG - Intergenic
1139998888 16:71007023-71007045 AGAAGAGAAGAGAGGGATAGAGG - Intronic
1140176890 16:72670062-72670084 AGAAGAAAACAAAAGAATAAAGG + Intergenic
1140185154 16:72763029-72763051 ATCAGAAAGCAAAAGGATAGAGG + Intergenic
1140535258 16:75703964-75703986 AGGAAAAAAAAAAAGGATGGGGG - Intronic
1141287021 16:82681977-82681999 AGGAGAAACCAGGAGGGAAGAGG - Intronic
1141486983 16:84347060-84347082 GGGAGAGAACAGAAGGAGACTGG + Intergenic
1141540763 16:84719291-84719313 AGCAGAAAACAGGAGGATGAGGG - Intronic
1141916195 16:87098864-87098886 AGGAGGTAAAAGTAGGATAGGGG + Intronic
1141992877 16:87620472-87620494 AGGAGAGAAGAGAGGGAGAGGGG + Intronic
1142768334 17:2078717-2078739 AGGAGTAAAAGGAAGGATGGAGG + Intronic
1143440388 17:6967652-6967674 AGAAGGCAAAAGAAGGATAGAGG + Intronic
1143925558 17:10366249-10366271 AGGAGAGAAGGGAAGGAAAGAGG - Intronic
1144214047 17:13039096-13039118 AGGAGGAAGCAGATGGATATTGG + Intergenic
1145395743 17:22492976-22492998 AGGAGAAAACAAAATGAAAATGG - Intergenic
1146587997 17:34099483-34099505 AGGAGGGAAAAGAAGGAAAGAGG + Intronic
1147055220 17:37828929-37828951 AGGAGACAACGGAAGGAAAGAGG - Intergenic
1147308428 17:39579259-39579281 TGGGAAAAACAGAAGGAGAGAGG + Intergenic
1147348459 17:39821380-39821402 AGGATAAAATAAAAGGGTAGGGG + Intronic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148193807 17:45698944-45698966 AGGGGACAAGAGAAGGAAAGGGG + Intergenic
1148398108 17:47326426-47326448 AGGGGAAAAGAGAGGGAGAGAGG - Intronic
1148510963 17:48169446-48169468 AGTAGACAACAGAAGGAAATAGG + Intronic
1148724151 17:49776691-49776713 AGGAGAAACCAGAAGATTAAAGG + Intronic
1148904936 17:50905855-50905877 ATGAGAAAACAGAAGTGTAGCGG - Intergenic
1149328070 17:55553548-55553570 AGGAGAACACAGAAAGTGAGGGG - Intergenic
1150008041 17:61481708-61481730 TGGAGAAAACAGGAGGAGGGAGG + Intronic
1150487497 17:65554106-65554128 AGGAGATAAGAACAGGATAGGGG - Intronic
1150989254 17:70236895-70236917 TGCAGAAACCAGAAAGATAGTGG + Intergenic
1151169455 17:72234771-72234793 AGGAGAAAACACAAGGACGAAGG + Intergenic
1151288616 17:73132158-73132180 AGGAGAAAACAAAAGGGAACGGG - Intergenic
1153177875 18:2399428-2399450 AAGACAAAACAGAAGGATTCTGG + Intergenic
1153328893 18:3851874-3851896 AGAAGAAAACAGGAGGTTACTGG + Intronic
1154016263 18:10620586-10620608 AGGTAAAAACAGAAGGCCAGAGG - Intergenic
1154276993 18:12970398-12970420 AAGAAAAAACAGATGGACAGGGG - Intronic
1154406174 18:14093288-14093310 AGGAGAAAGCGGCAGGATGGAGG - Intronic
1155346043 18:24858028-24858050 AAGAGAAAAAAAAAAGATAGCGG + Intergenic
1155502281 18:26498931-26498953 AGTAGAAGACAGAGGGAGAGAGG - Intronic
1155668392 18:28338453-28338475 AGGAGAAAACAACAGTGTAGGGG + Intergenic
1156043863 18:32856317-32856339 AGGAGAAAACTGAAGCATAAAGG + Intergenic
1156358714 18:36364894-36364916 GGGAGAAAGCAGAAGGGTGGTGG + Intronic
1156605084 18:38656903-38656925 AGGAGAAAACACAGGCAAAGGGG - Intergenic
1156727973 18:40152621-40152643 AGGAGAAAACAGAAATAAAGAGG - Intergenic
1156999922 18:43511675-43511697 AGGAAAACCCAGAAGGAAAGTGG - Intergenic
1157052784 18:44187754-44187776 AAGAGAAAACAGAAGGTTTAGGG + Intergenic
1157070564 18:44403046-44403068 AGAAGAAAACAGAAGCAGAGTGG - Intergenic
1157830617 18:50854009-50854031 AGAGGAAACCAGAAGGATAAAGG + Intergenic
1158305990 18:56105955-56105977 AGGAGAAAACAAAAGACCAGTGG - Intergenic
1158307401 18:56121271-56121293 AGGAGAAAGCAGAAAGGTATAGG - Intergenic
1158421602 18:57299705-57299727 AGGTGAAAACAGGATGAAAGTGG + Intergenic
1158642966 18:59219452-59219474 AGGAGAAGAGAGAAGGGGAGTGG + Intergenic
1159013147 18:63078109-63078131 AGGAGATAACTGAATCATAGGGG + Intergenic
1159583427 18:70260768-70260790 AAGGGAAAACAGATGGAAAGTGG + Intergenic
1159951496 18:74487370-74487392 AGGGGAAAACAGGAGGCGAGGGG + Intergenic
1160204081 18:76819071-76819093 AGGATAAAACACAATGATAGTGG + Intronic
1160287526 18:77558686-77558708 AGGAGAAAACAAGAGGAGTGTGG - Intergenic
1161137445 19:2628042-2628064 AGGAGAAAACAGTAGCTGAGAGG - Intronic
1161803548 19:6429521-6429543 AGGAGAAAGGAGGAGGAAAGAGG + Intronic
1161817260 19:6507070-6507092 AAAAGAAAAAAGAAGCATAGGGG - Intergenic
1161829050 19:6589715-6589737 AAGAGAAAAAAGACAGATAGAGG - Intronic
1161847309 19:6719120-6719142 GGGAGAAGACAGAAGGGGAGGGG + Intronic
1161864025 19:6821098-6821120 AGGATTAAATAGAAAGATAGAGG + Intronic
1162267968 19:9591547-9591569 AAGAGAATTCAGAAGGAAAGTGG - Intergenic
1162448818 19:10741980-10742002 AGGAAAAGAAAGAAGGGTAGAGG - Intronic
1162517839 19:11160254-11160276 AGGAGATAACAGAAGGTTTTTGG - Intergenic
1162887449 19:13706312-13706334 GGGAGGAAAGAGAAGGACAGAGG - Intergenic
1165231581 19:34390589-34390611 AGGAGATAACAGCAGGTTACAGG + Intronic
1165379466 19:35468107-35468129 AGCAGAAAAAAGAAGAAAAGTGG + Intergenic
1165585134 19:36908490-36908512 AGGAGAAAAGAAAAAGATGGCGG + Intronic
1166527862 19:43524426-43524448 GGGGGAAAAGGGAAGGATAGGGG + Intronic
1166933669 19:46317828-46317850 AGAAGAAAAAAAAAAGATAGTGG - Intronic
1167018929 19:46860439-46860461 TGGAGAAAGCCGAAGGAGAGAGG - Intergenic
1167028616 19:46941083-46941105 AGCATAAAACAGAAAGAAAGGGG - Intronic
1167306373 19:48712374-48712396 AGGAGAAACCAGCAGAAGAGTGG - Intergenic
1167322348 19:48805011-48805033 AGGAAAAAACAGAGGGAGGGAGG + Intronic
1168125599 19:54280773-54280795 AGGAGAAACCAGACAGACAGTGG - Intronic
1168171654 19:54593946-54593968 AGGAGAAACCAGACAGACAGTGG + Intronic
1168328399 19:55550514-55550536 AGGAGAAAACTGAAGCGCAGAGG - Intergenic
925301021 2:2812516-2812538 AGCAGAAAACAGAGGTTTAGAGG - Intergenic
925654685 2:6133481-6133503 AGAAAAAGAAAGAAGGATAGAGG + Intergenic
925800485 2:7594448-7594470 ACGAGAGAACAGCAGGAGAGGGG - Intergenic
925827614 2:7864873-7864895 AGGAGAAAAGAGAAATAAAGCGG + Intergenic
926001469 2:9336755-9336777 AGGAGAAAATAGTGGGCTAGCGG + Intronic
926077810 2:9955830-9955852 AGGTGAATCCAGAAGGAGAGCGG - Intronic
926340061 2:11898048-11898070 AGGAGGGATCAGAAGGATAGGGG + Intergenic
926887213 2:17609255-17609277 AGGAGAAGACAGAGGAGTAGGGG + Intronic
927083168 2:19650270-19650292 AGGAGAGAAAAGAAAGAGAGGGG + Intergenic
927236835 2:20882437-20882459 AAGAGAAAAGGGAAGGATAAGGG - Intergenic
927289404 2:21390562-21390584 AGTAGAAAACATGAGGATGGGGG + Intergenic
927490470 2:23517957-23517979 AGGAGAACACTGAAGCACAGAGG - Intronic
927989618 2:27438497-27438519 AGGAGAGAAAAGAAGACTAGTGG + Intronic
928054040 2:28032700-28032722 AGGTGAAAACAGATGCATATTGG + Intronic
928963823 2:36957200-36957222 AAGACAAAACAGAAGTATATTGG + Intronic
929408819 2:41673321-41673343 GGGAGAAAACAGAGATATAGAGG - Intergenic
929547194 2:42863382-42863404 AGGGGAAAAGAGTAGGAGAGTGG + Intergenic
929783032 2:44969958-44969980 AGGAGAAAAGAAAAGGAAAAAGG + Intergenic
929913706 2:46115846-46115868 AAGAGAAAACAGAAGGCAAAGGG - Intronic
929982731 2:46697111-46697133 AGAAGAAAGCAGAAGGAAGGGGG + Intergenic
930288101 2:49459427-49459449 AGGAAAAAAAAGGAGGAAAGAGG + Intergenic
930430001 2:51263727-51263749 ATGAGAAAACAGAAGCAGATAGG + Intergenic
930514344 2:52387274-52387296 AAAAAAAAACAGAAGAATAGGGG - Intergenic
930571721 2:53094516-53094538 AGGAGAAAAGAGATGGAGAAGGG + Intergenic
930837481 2:55809715-55809737 AGAAGAAAACATGAGGATATTGG + Intergenic
931159917 2:59677735-59677757 AGGAGAAATCTGAACCATAGTGG + Intergenic
931223684 2:60310712-60310734 AGGAGAAAAGAGCAGGATTCTGG + Intergenic
931402411 2:61943327-61943349 ATGAAAAAACACAAGGAGAGTGG - Intronic
931585340 2:63820362-63820384 AGGAGACAACAGAAAGCTTGTGG + Intronic
931663305 2:64590189-64590211 ATAAGAAAACAGAAGGAATGAGG - Intronic
932011838 2:67986087-67986109 AGGAGCAAAGAGTAGAATAGTGG + Intergenic
932208153 2:69902248-69902270 AGGAGAAGAAAGAAGGAAGGAGG - Intronic
932618309 2:73250241-73250263 AGGACAATACAGTAGGATGGTGG + Intronic
932626160 2:73297572-73297594 AGGAGAAGAAAGAAGCAGAGAGG - Intergenic
932641651 2:73453515-73453537 AGGTGCATACAGAAGGATATTGG + Exonic
932749634 2:74363182-74363204 GGATGAAAAAAGAAGGATAGTGG + Intronic
932875459 2:75446691-75446713 GGGAGGAGGCAGAAGGATAGGGG - Intergenic
933389626 2:81653448-81653470 AAGAGAATTCAGAAGGAAAGTGG - Intergenic
933421832 2:82057423-82057445 AGAAGAAAAGAGATGGAGAGAGG + Intergenic
933740842 2:85532772-85532794 AGGAGAAAAGAGGAGGGGAGGGG - Intergenic
934018084 2:87911332-87911354 GGCAGAAATCAGAGGGATAGAGG + Intergenic
934576655 2:95405988-95406010 AGGAGAAAACTGAGAGCTAGGGG + Intronic
934638877 2:96014156-96014178 AGGAGAAAACTGAGAGCTAGGGG + Intergenic
934695286 2:96395624-96395646 AGGAGGAATCAGGAGGAAAGAGG + Intergenic
934794774 2:97091255-97091277 AGGAGAAAACAGAGAGCTAGGGG - Intronic
935092218 2:99906276-99906298 AGGAGGAAAGAGAAGCAAAGAGG + Intronic
935257955 2:101329147-101329169 AGGAGATATTAGAAGGAGAGAGG + Intergenic
935281891 2:101525631-101525653 AGGAGAATAAAGAAGGATACTGG + Intergenic
935486383 2:103659833-103659855 AGGAGAAAAAAGAGTGATAAAGG - Intergenic
935912983 2:107917498-107917520 AGAAGCAAAGAGAAGAATAGTGG + Intergenic
935982298 2:108639289-108639311 AGGAGAAAAAAAAGGGACAGTGG + Intronic
936040650 2:109146795-109146817 AGAGGAAAACAGAAGGAATGGGG - Intronic
936805599 2:116328142-116328164 AGGACAAAACAGAAAAATATTGG - Intergenic
937639824 2:124199192-124199214 AGGAGAAAATGAAAGGACAGAGG + Intronic
937682867 2:124663532-124663554 AGGATAAAACATTAGGATATTGG + Intronic
937777978 2:125803794-125803816 TGGAGATAACTGAAGCATAGGGG - Intergenic
938045278 2:128113581-128113603 AAGAGAAAACAGAAGAAAAAAGG - Intronic
938194654 2:129316189-129316211 AGGGGAAAAAAAAAGGACAGAGG + Intergenic
938563328 2:132494397-132494419 ATGAGAAAACAGAAGGAACAAGG - Intronic
938859292 2:135350301-135350323 AGGAGAAGAAAGAAGAATAGAGG + Intronic
938899668 2:135789492-135789514 AGAAGAAAACAGACTGAGAGAGG + Intronic
939346800 2:140976231-140976253 AGGAGAAGAGAGAAGAAGAGAGG - Intronic
939413857 2:141866817-141866839 GAGAGAAAATAGAAGGAGAGAGG + Intronic
939435513 2:142172084-142172106 AGAAGAAGATAGTAGGATAGAGG + Intergenic
939908533 2:147950427-147950449 GGGAGAGAACAAAAGTATAGAGG - Intronic
940115513 2:150204196-150204218 AGGAGAAAGAAGAAAGAGAGAGG + Intergenic
940557448 2:155248683-155248705 AGGAGAAAGGAGAAGGAAAGAGG + Intergenic
940750092 2:157616108-157616130 AGAAGAAAACAGAGGGAGAATGG - Intronic
940783712 2:157959922-157959944 AGAAGACAACAGAAAGATATGGG - Intronic
941451607 2:165666723-165666745 AGAGGAAAACAGAAAGAGAGAGG + Intronic
942193562 2:173495007-173495029 AGGAGGAAATAGAAGTCTAGGGG + Intergenic
942286978 2:174429176-174429198 AGGAGAGAAGAGGAGTATAGGGG - Exonic
942513541 2:176728106-176728128 AGGGGAGAAAAGAAGGGTAGTGG - Intergenic
942724364 2:178990559-178990581 AGGAAAAAAGAGAAGGGGAGGGG + Intronic
942989643 2:182184137-182184159 AGGAGAGAACAGAGAGAAAGAGG + Intronic
942994560 2:182245540-182245562 AGGAGACAGCAAAAAGATAGTGG - Intronic
943264448 2:185709733-185709755 ATAAGAAAACAAAAGGATATGGG + Intergenic
943480685 2:188412992-188413014 AGGAGAAAACTAAAGTCTAGAGG + Intronic
943580179 2:189674841-189674863 AGGGGAAAAAACAAGGAAAGGGG - Intronic
943659903 2:190548070-190548092 TGGAGCAAATAGAAGGAAAGAGG + Intergenic
943843349 2:192607120-192607142 AGAAATAAACAGAAGGAAAGAGG - Intergenic
945073249 2:206012194-206012216 TGGAAAATACAGAAGTATAGGGG + Intronic
945223962 2:207512817-207512839 TGGAGCAAACAGAAGGAGAGTGG + Intergenic
945492158 2:210468879-210468901 AAAAGAAAACAGAAGTATAGTGG - Intronic
945593600 2:211765138-211765160 ATGAGAAAAATGAGGGATAGAGG + Intronic
945612303 2:212019104-212019126 AGCAGCAAAGAGAAGGGTAGAGG + Intronic
945779153 2:214146342-214146364 GGGAGAAAGAAGAAGGATACAGG + Intronic
945919697 2:215743144-215743166 AGGAGACATCAGAAGGGCAGTGG + Intergenic
946693891 2:222333204-222333226 AGCAGAATACAGTATGATAGGGG - Intergenic
946986667 2:225281445-225281467 AGGAGGAAACAGAAAGAGTGAGG - Intergenic
947610331 2:231521404-231521426 AGGAGCAGAGAGCAGGATAGAGG + Intergenic
947658784 2:231851057-231851079 ATGAGGAAACTGAAGGTTAGAGG + Intergenic
947752082 2:232538449-232538471 GGGAGAAAACAGGAGGGTGGAGG + Intergenic
948466532 2:238154560-238154582 GCAAGAAAACAGAAGGATACAGG + Intergenic
948554465 2:238797839-238797861 AGGAGTAAACAGATGGGTAGCGG - Intergenic
1169100744 20:2946393-2946415 ACAACAAAACAGAAGGAGAGAGG + Intronic
1169400094 20:5272273-5272295 AGGAGAAATCAGTAAGAAAGCGG - Intergenic
1169638494 20:7721627-7721649 GGGAGAAGAGAGAAGGAAAGAGG - Intergenic
1169913197 20:10663834-10663856 AGGGGAGAACAGAAGGCAAGAGG + Intronic
1170063538 20:12286090-12286112 AGGAGAAAACAGGATCAGAGAGG - Intergenic
1170271919 20:14537064-14537086 AACAGAAAACAGAAGGAAGGGGG - Intronic
1170323787 20:15133232-15133254 AGGAGAAAACAGTATGAGAAAGG + Intronic
1170370664 20:15644467-15644489 GTAAGAAAACAGAAGGAAAGAGG - Intronic
1170778107 20:19397267-19397289 AGGAGAAAAAATATGGATTGTGG - Intronic
1171293624 20:23997440-23997462 AGAAGAAAACAGCAGGCTTGAGG + Intergenic
1171399583 20:24864044-24864066 AGAAGAATACAGAATGATATGGG + Intergenic
1171879592 20:30608517-30608539 AGGAGAAAAGAGGAGAACAGAGG + Intergenic
1171905053 20:30893704-30893726 AGGAGAGAACAGAGGGAAGGAGG - Intergenic
1172422901 20:34832525-34832547 AGGTGAAAAAATTAGGATAGTGG - Intergenic
1172527319 20:35607659-35607681 AGGAGAGGACCGAGGGATAGGGG + Intergenic
1172589345 20:36106240-36106262 AGGACAAAAGGGAAGGAGAGCGG - Intronic
1173058568 20:39639776-39639798 AGGTGAAAACACAAAGATAGAGG + Intergenic
1173240379 20:41290642-41290664 ATGAGAAAACAGATGCAGAGAGG + Intronic
1173316373 20:41948326-41948348 AGCAGAAAACAGCAAGCTAGAGG - Intergenic
1173397707 20:42696090-42696112 AGGGGAAGAGAGAAGGAGAGAGG - Intronic
1173562727 20:44017769-44017791 ATGAGAAAACAGAGGCACAGAGG + Intronic
1173678169 20:44856174-44856196 AGAAGAAAAAAGAAGGAGAAAGG + Intergenic
1174335193 20:49854700-49854722 AGGAGAAAACCGAGGGACAACGG - Intronic
1174762599 20:53221038-53221060 AGGAGATAACTGAATCATAGGGG + Intronic
1175010968 20:55735625-55735647 AGGAGAAAGAGGAAGGATGGAGG - Intergenic
1175523426 20:59617802-59617824 AGGAGAAAGAAGAAGGACAGAGG - Intronic
1176768877 21:13051670-13051692 AGGAGAAAACAAAAGTTTGGTGG + Intergenic
1177028152 21:15948217-15948239 AGGAGATAACAAATGGATAAGGG + Intergenic
1177248255 21:18559060-18559082 AGTAGAAAACAGAAGAATGTTGG - Intergenic
1177359461 21:20049456-20049478 AGAAGAAGACAGAAAGATACAGG + Intergenic
1177444676 21:21177709-21177731 GGGAAAAAAGAGAAGGAGAGGGG - Intronic
1177505931 21:22016952-22016974 AGAAGCAAACAGAAGGGTTGGGG + Intergenic
1178172728 21:30059946-30059968 AGGACAAAACAGAAGTAAACAGG - Intergenic
1178584722 21:33862487-33862509 AGGAGAAGAGGGAAGGAGAGAGG + Intronic
1178598346 21:33974757-33974779 AAGGGAAAAAAGAAGGAAAGAGG - Intergenic
1178758907 21:35381463-35381485 AGGAGGAAACTGAGGAATAGAGG + Intronic
1179084847 21:38207573-38207595 AGGAGAAAAGAGGAGGGGAGAGG - Intronic
1179311071 21:40196600-40196622 AGGGAGGAACAGAAGGATAGAGG - Intronic
1179370332 21:40800941-40800963 AGGAGAAGAAAGAAAGAAAGAGG - Intronic
1179385547 21:40938480-40938502 GGGAGAAAACAGACAGATGGGGG - Intergenic
1179488580 21:41726452-41726474 AGGAGGAGAAAGAAGGAGAGAGG - Intergenic
1180316845 22:11283630-11283652 AGGAGAGAACAGAGGGAGGGAGG + Intergenic
1181825067 22:25508344-25508366 AAGAGAAAACTGAAGCAGAGAGG + Intergenic
1181891800 22:26069765-26069787 AGGAGGAAAAAGAAAGAGAGGGG - Intergenic
1182003004 22:26936471-26936493 AGGAAAAAACGGAAGGAAAAGGG - Intergenic
1182311693 22:29413089-29413111 AGAAAAAAACACCAGGATAGGGG + Intronic
1182584355 22:31335448-31335470 AGGTCAAAACAGAAGGAGAGAGG - Intronic
1182957255 22:34438167-34438189 AGGAAAGAACAGAAGAATAGAGG + Intergenic
1182975283 22:34618343-34618365 AGCAGAAAAAAGATGGGTAGAGG - Intergenic
1183590587 22:38777253-38777275 AGGAGAGAACAGATGCAGAGCGG + Intronic
1183791154 22:40071115-40071137 AGCAGAAAAAAAAAGGAAAGTGG - Intronic
1184131882 22:42521399-42521421 GGGAGATAACAGAACGATGGTGG - Intergenic
1184444879 22:44541209-44541231 AGGAGCAGACAGCAGGGTAGGGG - Intergenic
949677320 3:6470820-6470842 AGGAAAAAAAAAAAGGATAATGG - Intergenic
949939550 3:9144327-9144349 AGGGGAAGAGAGAAGGCTAGGGG - Intronic
950037753 3:9899445-9899467 AGGAGAGAAGAGAGGGAAAGAGG - Intergenic
950846305 3:16019131-16019153 AAGAGAATTCAGAAGGAAAGTGG - Intergenic
950895623 3:16447967-16447989 AAGAGAGAAAAGAAGGAGAGAGG - Intronic
950951491 3:17004591-17004613 ATGAGAAAAAAGAAGAAAAGGGG - Intronic
951249084 3:20373180-20373202 AGGAGGAAAGAGAAGGGAAGAGG + Intergenic
951289706 3:20860830-20860852 AGGAGAAAACAAGAAGAAAGTGG + Intergenic
951412343 3:22380215-22380237 AGGAGAAATCAGTAGGAGAGTGG + Intergenic
951742695 3:25941827-25941849 AGGAGAAAAGATAAGGAGGGAGG - Intergenic
951823533 3:26841821-26841843 AGGAGAAATCAGAAGGAATGAGG - Intergenic
952388453 3:32860070-32860092 AGGAGAGAACAGGAGGAGAGGGG - Intronic
952650195 3:35717031-35717053 AGGAGAAAAGAGATTGATATAGG - Intronic
952910013 3:38175819-38175841 AGGAGAGGACAGAAGAAGAGTGG + Intronic
953308419 3:41852589-41852611 AGAAGAAAACTGAAGAAAAGGGG + Intronic
953319959 3:41962630-41962652 GGAAGGAAACAGAAGGACAGTGG - Intergenic
953327629 3:42026068-42026090 ATGAGAATACAGAAAAATAGAGG - Intronic
953874014 3:46654383-46654405 AGGAGAATACAGATGGCAAGGGG + Intergenic
953917162 3:46927425-46927447 GTGAGAAATCAGAAGGAGAGAGG + Intronic
954213816 3:49113047-49113069 AGGAGAGAGCAGCAGGATAGAGG + Intronic
954344661 3:49986766-49986788 AGAAGAAAAGAGAAGGGGAGGGG - Intronic
954560946 3:51556111-51556133 AGGAAAAAACAAAAGGGGAGGGG - Intronic
955391417 3:58524955-58524977 AGCTGAAAAAAGAAGGATAGAGG + Intronic
955475336 3:59330384-59330406 AGGAGAAAGGAGAAGGAGAAAGG + Intergenic
956516142 3:70050409-70050431 AGAAGAAAACCGAAGGCTATAGG + Intergenic
956624108 3:71249779-71249801 GGGAGAAGACAGAAGAATAAAGG + Intronic
957317618 3:78588397-78588419 AGCAAAGAACAGGAGGATAGGGG + Intergenic
957596815 3:82277642-82277664 AGAACTAAACAGAGGGATAGGGG - Intergenic
957901219 3:86494803-86494825 AGGAGAATACAGAAGAAAAAAGG + Intergenic
958113442 3:89182097-89182119 AGAAGAGAAGAGAAGGATAAAGG - Intronic
958479422 3:94627871-94627893 AGGAAGAAAGAGAAGGAGAGAGG - Intergenic
958562959 3:95771795-95771817 AGGAAATTACAGAAGGAGAGGGG - Intergenic
958871300 3:99562228-99562250 AGGAGAGAACAGAAGAAAGGAGG - Intergenic
959090764 3:101900259-101900281 GGGAGAAAACGAAAGGAGAGGGG + Intergenic
959364665 3:105442204-105442226 GGGAGAAAAAAGAAGTATAAAGG - Intronic
959576424 3:107939222-107939244 TCAAGAAAACAGAAGAATAGGGG - Intergenic
959583044 3:108001491-108001513 AGGAGAATGCAGAAAAATAGGGG + Intergenic
959615971 3:108347638-108347660 AGGAGACAACAGTAGGAAAAGGG + Intronic
959836958 3:110930103-110930125 AGGAGGAAACAAAAAGATAAAGG + Intergenic
959956676 3:112246969-112246991 AGGAGAAAACTGGAGGAAAATGG - Intronic
960217804 3:115064246-115064268 AGGAGAAAAGACCAAGATAGAGG - Intronic
960266140 3:115623383-115623405 AGGAGAAAAAAGGAGAAGAGAGG + Intronic
960803385 3:121560551-121560573 AGGAGACGACAGAAGGCTAAAGG - Intergenic
961185915 3:124914981-124915003 AGGAGCAAAAAGAAGGATGAGGG + Intronic
961859706 3:129905839-129905861 AGAAGAAAACCTAAGGAAAGTGG + Intergenic
962113495 3:132475511-132475533 AGGAGAAACAAGAAAGATGGTGG + Intronic
962211117 3:133478808-133478830 AGAAGAAAACAAAAGGAGAGGGG + Intergenic
962376735 3:134864488-134864510 AGGGCAAAACAGAATGAGAGAGG - Intronic
962590190 3:136881707-136881729 AGGAGAAACATGAAGAATAGTGG - Intronic
962670185 3:137697355-137697377 AGGAGAAAACAATGGGAAAGAGG + Intergenic
962908230 3:139824675-139824697 AGGAGAAAACAGAGGCCTGGAGG + Intergenic
962930370 3:140030422-140030444 AGAAGTAGACAGAAGGAGAGTGG + Intronic
963262035 3:143202479-143202501 AGAAGAAAACAGATGGGTAGAGG + Intergenic
963521330 3:146362544-146362566 AGCAAAAAACAGGAGGACAGGGG - Intergenic
963632688 3:147752763-147752785 AAGAGGAAACAGAAGGAAAGGGG + Intergenic
963765502 3:149331279-149331301 AGGAGAAAGGAGAAGAATATAGG - Intronic
963863019 3:150330345-150330367 AGGAGAAGAAAGAAAGAAAGAGG + Intergenic
963880508 3:150523413-150523435 AGGTGAAAAGTGAAGGATTGAGG + Intergenic
964431109 3:156606537-156606559 AGCAGCAAACAGCAGGAAAGCGG - Intergenic
965297255 3:166964566-166964588 AGAAGAAAACATAAGGAAAATGG - Intergenic
965503530 3:169484278-169484300 AAGAGAAAAAAGAAAGAAAGAGG + Intronic
965565436 3:170111467-170111489 AGAAGAAAAAAGAAGGGTGGGGG + Intronic
965636006 3:170781492-170781514 AGGAGATAACAGAGGTATAGCGG - Intronic
966026881 3:175294979-175295001 ATGAGAAAACAGAAGCATAGAGG - Intronic
966141538 3:176762619-176762641 AAGAGAAAACAGAAAAAAAGGGG + Intergenic
966427739 3:179798427-179798449 AGGAGGAGACAGAGGGATAGGGG - Exonic
966657792 3:182378928-182378950 AGGAGAAAAGTAAAGGTTAGGGG + Intergenic
966900368 3:184479470-184479492 AGAAGAAAACAGAAAGTCAGAGG - Intronic
966978696 3:185109566-185109588 AGAAGAAAACCGGAGGAAAGGGG + Intronic
966990471 3:185225109-185225131 ATGAGAAAACAGAGGCTTAGAGG + Intronic
967267694 3:187705167-187705189 GGGAGAAAAAAAAAAGATAGGGG + Intronic
967530184 3:190540304-190540326 AGAAAAAAACAGAAGGACAAAGG - Intronic
967941645 3:194770950-194770972 AGAAAAAACCAGCAGGATAGTGG - Intergenic
968975363 4:3819587-3819609 GGGAGAAATCAGAAAGAAAGAGG + Intergenic
969172932 4:5378511-5378533 AGAAGAAAACAGAAAGATAAAGG - Intronic
969255054 4:5995853-5995875 AGGAGAAAACAGAAGTGAACAGG + Intergenic
969935538 4:10676789-10676811 GGAAGAAAAATGAAGGATAGAGG - Intronic
969966939 4:11006201-11006223 AGGAGAACACAGAGGGAAACTGG + Intergenic
970045296 4:11845748-11845770 AAAAGAAAATAGTAGGATAGAGG - Intergenic
970675551 4:18445079-18445101 AGGAGAGAGGAGAAGGATAAAGG + Intergenic
970815961 4:20156311-20156333 AGGGGATAACACAAGTATAGGGG + Intergenic
970874711 4:20856029-20856051 AGGAGAAAATTGAAGGATTTTGG - Intronic
971192607 4:24441675-24441697 AGGAAGAAACAGAAGGAAGGAGG + Intergenic
971508105 4:27388536-27388558 AGGAGAAGACAAAGGGAAAGGGG + Intergenic
971606313 4:28662558-28662580 AGGAGAGTACAGAAGGATCTGGG + Intergenic
971806664 4:31367095-31367117 AGGAGAAAAATGAAGGAGACAGG + Intergenic
972270326 4:37504303-37504325 AGTACAAAACAGCATGATAGTGG - Intronic
972400325 4:38695928-38695950 AAGAGAAAAGGGAAGGAAAGTGG + Intronic
972554321 4:40165974-40165996 AGAAGAAAACAGAAAGAAAATGG - Intergenic
973181064 4:47268418-47268440 AGTGGAAAAGAGAAGGGTAGGGG + Intronic
974166724 4:58213942-58213964 TTGAGAATACAGAAGGATTGGGG + Intergenic
974214608 4:58828792-58828814 AGAAGAAAACAGAAAGATATGGG - Intergenic
974556808 4:63461346-63461368 AGAAGAAAACATAAAGATAAAGG - Intergenic
974624209 4:64400719-64400741 AGGAGAAAAGAGGAAGAGAGGGG - Intronic
974848075 4:67375685-67375707 AGGAGAATATAGAAGTACAGAGG - Intergenic
975005079 4:69273828-69273850 AGAAGAAAACAGAAAGATGTGGG + Intergenic
975013504 4:69382808-69382830 AGAAGAAAACAGAAAGATGTGGG + Intronic
975603566 4:76128893-76128915 AGAAGAAAAGAGTAGAATAGTGG + Intronic
975840709 4:78470823-78470845 AGGAGGAAACAGAAAGAGAGGGG + Intronic
976615238 4:87069493-87069515 AGGAGAGAAAAGATGGAGAGAGG - Intronic
977046301 4:92072297-92072319 AGGAGAAAACAGAAAGATGTGGG - Intergenic
977053595 4:92162012-92162034 AGGTGAAAACTGAAGAAGAGAGG + Intergenic
977334065 4:95673850-95673872 AAGAGAATACTGAAGGAAAGTGG - Intergenic
977783938 4:101010836-101010858 GGGAGAAAACAAAAGGGGAGGGG + Intergenic
978264929 4:106812383-106812405 AAAAGAATACAGAAGGAAAGAGG - Intergenic
979026541 4:115584537-115584559 ATGAATAAACAGAAGGCTAGTGG - Intergenic
979104213 4:116664052-116664074 AGGAGAAAAAAAAAGGAAACAGG - Intergenic
979119688 4:116882170-116882192 AGGAGAAAATACAAGGAAATTGG - Intergenic
979228850 4:118323193-118323215 AGGACAAAACAGGAGGAGACAGG + Intronic
980223574 4:129951137-129951159 AGGAAAAGACAGAAGGAGGGAGG + Intergenic
980282869 4:130742880-130742902 AGAAGAAGACAGAAAGATATGGG + Intergenic
980877096 4:138672591-138672613 AGGGGAAAACAGAAGCAAACTGG - Intergenic
981678643 4:147368422-147368444 AGAAGAAAACAGAATAATAATGG - Intergenic
982047513 4:151463581-151463603 AGGAAAGAACAGAAGGCTGGGGG - Intronic
982187418 4:152816842-152816864 AGGAGGAATAAGAAGGAGAGTGG - Intronic
982391674 4:154871191-154871213 AGGAGGAGGCAGAAGGAAAGAGG + Intergenic
982489406 4:156010504-156010526 AAGAGAAAACAAAAGGAAATTGG + Intergenic
982603348 4:157481432-157481454 AGAAGTAAACAGTAGAATAGTGG + Intergenic
982822568 4:159961332-159961354 AGAAGTAAAGAGAAGAATAGTGG - Intergenic
983145060 4:164203269-164203291 AGAAGGAAAGAGAGGGATAGGGG + Intronic
983674764 4:170279830-170279852 AGGAGAAAACACAGGGGAAGTGG - Intergenic
983744098 4:171173168-171173190 ACTAGAAAACAGAAACATAGGGG - Intergenic
984120300 4:175733726-175733748 AGAATAAAACACAAAGATAGAGG + Intronic
984796451 4:183664804-183664826 AAAAGAAAAAAAAAGGATAGGGG - Intronic
984825136 4:183917301-183917323 AGGAGCAAACTGAAGGAAACTGG + Intronic
985043369 4:185915594-185915616 AGGACAAAAGAGAAGGAAAGAGG - Intronic
986170774 5:5312756-5312778 AGAAGAAAACAAAAGGAAGGGGG - Intronic
986917323 5:12637381-12637403 AGGAGACAACAGAATCATAGGGG - Intergenic
986961116 5:13214144-13214166 TAGATAAAACAGAAGGATAAGGG - Intergenic
987126293 5:14815960-14815982 ATGAGCAAACAGAAAAATAGGGG - Intronic
987249954 5:16089871-16089893 GTGAGAAAACAGAAGTATGGAGG + Intronic
987756890 5:22108128-22108150 AGGAGATAACTGAATCATAGGGG + Intronic
988113771 5:26856357-26856379 AGAAGAAAGCAGAAAGATAAAGG - Intergenic
988393364 5:30664787-30664809 AGGAGAAAACATACGCACAGAGG + Intergenic
988420369 5:30998773-30998795 AGCAGAAAACAGAAGAACATGGG + Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
988475384 5:31580373-31580395 AGGAGAAAAGAGGAAGATAACGG - Intergenic
988600898 5:32638631-32638653 AGAAGAAAAGAGAAGGGAAGGGG + Intergenic
988627423 5:32892511-32892533 ATGAGATAACAGGAGCATAGAGG + Intergenic
988837577 5:35048159-35048181 AGAAGAGAACAGAAGGGAAGAGG + Intergenic
989410484 5:41114153-41114175 CAGAGAAAACAGAAGTATACAGG - Intergenic
989613694 5:43318783-43318805 AAGAGAATTCAGAAGGAAAGTGG - Intergenic
990430760 5:55733207-55733229 AGAAGAGAAGAGAAGGAAAGAGG - Intronic
990510119 5:56481898-56481920 AGGAAAAAAGAGAGGGGTAGGGG + Intronic
990782520 5:59381908-59381930 AGGAGAAAACAAAAAACTAGGGG + Intronic
990951833 5:61305961-61305983 ATGAGAAAACAGAGGGATGGGGG - Intergenic
991216071 5:64158530-64158552 AGGAAAACTCAGAAGGGTAGTGG + Intergenic
991344289 5:65646223-65646245 AGGAGAAAAAAGAAATATAATGG + Intronic
991374544 5:65953107-65953129 TGGAGAAAGCAGAAGCAGAGAGG - Intronic
991929897 5:71743984-71744006 AAGAGATAACAGAAAGATTGAGG - Intergenic
992002068 5:72445366-72445388 GGGTGAAAAAAGAAGGGTAGGGG + Intronic
992111275 5:73496670-73496692 AGGAGAAAAAAGTAGGAACGAGG + Intergenic
992298256 5:75349322-75349344 AATAGAAAACAGAATTATAGAGG - Intronic
992585054 5:78229967-78229989 AGGAGCAAACAGGATGGTAGAGG - Intronic
992666075 5:79010917-79010939 AGGAAAATATTGAAGGATAGTGG - Intronic
992707126 5:79407728-79407750 AGGAGAAGAGAGAAGGGCAGAGG + Intronic
992711216 5:79458934-79458956 AGGTGAAAAAAGAAAAATAGGGG - Intronic
992837579 5:80655276-80655298 AGGAAAAAAAAAAAGGATGGAGG - Intronic
993053488 5:82952781-82952803 AGGAGAAAGGAAAAGAATAGAGG - Intergenic
993425818 5:87763004-87763026 AGAAGAAACCAGAAGTACAGAGG - Intergenic
993589207 5:89773307-89773329 GGGAGAACACAGGAGGAAAGGGG + Intergenic
993856354 5:93080837-93080859 AAAAGAAAACAGAAACATAGGGG - Intergenic
993995053 5:94712774-94712796 TGGAGAGAACAGAAGGCTAAGGG + Intronic
994723664 5:103409592-103409614 AGTAGAAAACAGATGGAAAAAGG + Intergenic
994784446 5:104138530-104138552 AGGAAAAAACAGAAGGAAAGAGG + Intergenic
995357052 5:111250785-111250807 ATGAGAAAACTGAAGGGTAGGGG - Intronic
995485740 5:112638303-112638325 AGGGGTACACAGAAGGATGGAGG + Intergenic
995703684 5:114962723-114962745 AGAAGAAGACAGAAAGATGGGGG - Intergenic
995742100 5:115365945-115365967 AGGAGAAAAGGAAAGGATAAGGG - Intergenic
996216449 5:120872378-120872400 AGGAGAAAAAAGAAATTTAGGGG - Intergenic
996281042 5:121729243-121729265 AGGAGAAGACAGAAGGAGGCGGG - Intergenic
996529458 5:124512387-124512409 ATCAGAAGACAGAAGGAGAGAGG - Intergenic
996564099 5:124861808-124861830 AGAAGAAAAAAGAAAGAAAGGGG + Intergenic
996637047 5:125704702-125704724 GAGAGAAGACAGAAAGATAGAGG + Intergenic
996797922 5:127370795-127370817 AGGCGAAAAAAGAAGTATAAAGG - Intronic
997006503 5:129822872-129822894 AGGATAAAACACAAGGAAGGTGG - Intergenic
997037609 5:130211972-130211994 AGGAGAGAAGAGAATGAAAGAGG + Intergenic
997103491 5:130993966-130993988 AGGAGAGAGCAGAGGTATAGGGG - Intergenic
997183208 5:131854526-131854548 AGGAAAAAACAGAAGAATCCTGG + Intronic
997727930 5:136137682-136137704 AGAAGAAAACAGAAGAAGACTGG - Intronic
997870669 5:137502684-137502706 AGGAGAACACAGAGGCATGGAGG - Intronic
998242409 5:140459488-140459510 AGGAGAGTACACAAGGAGAGGGG + Intronic
998350079 5:141494781-141494803 TGGAGAAAACAGAGGGAAAGGGG - Intronic
998387267 5:141764675-141764697 ATGAGAAAACAGAAGCAGAGAGG - Intergenic
998855152 5:146387543-146387565 AAGAGAAAACAGATGGAGATGGG - Intergenic
998955049 5:147430193-147430215 GGAAGAAAAAAGAAGGATGGGGG + Intronic
999377341 5:151095931-151095953 TGGAGAAAAGAGAAGGACACTGG - Intergenic
999517361 5:152314582-152314604 AGGAGGAAAAAGAAGGGAAGGGG - Intergenic
999550945 5:152686767-152686789 GGGAGAAACCAGAGGGAAAGAGG + Intergenic
999908203 5:156166998-156167020 AGGAGAAATCAGAAGGAAGTAGG - Intronic
1000095195 5:157965591-157965613 AGAAAAAAACAGGAGGAAAGAGG + Intergenic
1000432560 5:161167693-161167715 GGAAGAAAACAGAAGTTTAGGGG + Intergenic
1000573239 5:162941450-162941472 AGGGGAATACAGAGGGATGGGGG - Intergenic
1000952528 5:167501574-167501596 AGGAGATAAAAGAAGGATTTGGG - Intronic
1000972204 5:167726873-167726895 AGGATAAAACTGAAAGCTAGGGG - Intronic
1001365312 5:171132280-171132302 AGGAGAGAAAAGAAGGAAGGAGG + Intronic
1001501141 5:172235590-172235612 AGAAGAAAACAGAGGGCAAGTGG + Intronic
1001883439 5:175265908-175265930 AGAAGAAGACAGAAAGAAAGGGG + Intergenic
1002194918 5:177496529-177496551 AGGAGAGAAGAGAAGGTGAGTGG + Intronic
1002464483 5:179399609-179399631 AGAAGAAGACAGAAAGATATGGG + Intergenic
1002682295 5:180976168-180976190 AGGAGGAAACACAAGGAAGGTGG - Intergenic
1002894079 6:1364959-1364981 AAGAGAACACTGAAGGATACAGG - Intergenic
1003103031 6:3191987-3192009 GGGTAAAAACAGAAGCATAGAGG + Intergenic
1003339939 6:5210346-5210368 ATGAGAAAACAGAGGGCTCGCGG + Intronic
1003425129 6:5994218-5994240 AGGAGGAAACTGAGGTATAGCGG + Intergenic
1003443485 6:6164689-6164711 AGGAGAGAACAGAAGAGAAGAGG - Intronic
1003466140 6:6381948-6381970 AGGAGATAAAAGAAGGAAGGAGG + Intergenic
1003577877 6:7314294-7314316 AGGAGAAAACAGACCCAGAGAGG + Intronic
1004196274 6:13508471-13508493 AGGAGAACAGACAACGATAGAGG - Intergenic
1004299863 6:14447521-14447543 GGGAGAAATCAGAAGGAAAAGGG + Intergenic
1004534052 6:16482420-16482442 AGAAAAACACAGAAGGCTAGAGG + Intronic
1004686244 6:17948098-17948120 AATAGAAAAAAGTAGGATAGAGG - Intronic
1004801440 6:19152935-19152957 AGGAGAAAAGAGAATTATTGAGG - Intergenic
1004817510 6:19328537-19328559 TGGAAAAGAAAGAAGGATAGAGG + Intergenic
1004904460 6:20223337-20223359 GAGAGAAAACAGAAAGAGAGGGG + Intergenic
1005072225 6:21872306-21872328 AGCAGAAAAGAGGAGGAAAGAGG - Intergenic
1005228612 6:23672495-23672517 AGAAGAAAACAGAAAGATGAGGG - Intergenic
1005351499 6:24940454-24940476 AGGAGAACAAAGTAGGAGAGAGG + Intronic
1005471124 6:26163683-26163705 AGGAGAAAAAAGAAAGAGAAAGG + Intronic
1005476536 6:26213719-26213741 AGGGGAAAACCCAAGGAGAGTGG + Intergenic
1006049706 6:31332365-31332387 AGGAAAACTCAGAAGGAAAGTGG - Intronic
1006191783 6:32213890-32213912 AAGAGGAAAGAGAAGGAGAGCGG - Intronic
1006586396 6:35117388-35117410 TGGAGAAGCCAGAAGGATGGAGG + Intergenic
1006650798 6:35549733-35549755 AGAAGAAAAAAGGAGGAAAGGGG - Intergenic
1006699186 6:35957908-35957930 AGGAGAGAAAAGAAGGATCTCGG - Intronic
1006900925 6:37500470-37500492 AGGAATAAACAGAAGCAAAGAGG - Intergenic
1007025685 6:38570567-38570589 ATCAGAAAACAGAAGAAAAGAGG - Intronic
1007227907 6:40327857-40327879 GGATGAACACAGAAGGATAGAGG + Intergenic
1007254364 6:40518372-40518394 AGGGGAAAACTGAGGTATAGAGG + Intronic
1007415243 6:41687814-41687836 AGGCCAAAAGAGAAGGAGAGAGG + Intronic
1007475530 6:42117318-42117340 ATGAGAAAACTGAAGCACAGAGG + Intronic
1007925555 6:45646858-45646880 GGTAGAAAACAGAAGAAGAGAGG + Intronic
1008259386 6:49346277-49346299 AGGAGACAGCAGAAGGATAAAGG + Intergenic
1008483307 6:52008773-52008795 ATGAGAAAACTGAAGTACAGAGG + Intronic
1010116832 6:72322686-72322708 AGGGGAAAACACAAGGTAAGTGG + Intronic
1010747922 6:79585241-79585263 AGGAGAAGAAAGAAGGCTATAGG - Intergenic
1010898114 6:81391678-81391700 AGAAGAAGACAGAAAGATATGGG + Intergenic
1010928039 6:81767372-81767394 AGGAGGAAACTGAAGCTTAGAGG - Intergenic
1010975694 6:82311254-82311276 AGGAGAAGAGAGAAAGATTGGGG - Intergenic
1011722641 6:90174979-90175001 AGGAGAAAACAATAGGAGAGAGG + Intronic
1011782545 6:90806237-90806259 AGGAGGTAAAAGAAGGATAAAGG - Intergenic
1011804615 6:91057990-91058012 AGAAGAAAAAAGAAGGGAAGGGG - Intergenic
1012607027 6:101170185-101170207 AGGGAAAAAATGAAGGATAGAGG - Intergenic
1012911388 6:105121790-105121812 AGGAGGAAAGAGAAGGCAAGTGG - Intronic
1013490600 6:110642830-110642852 AGGAGAAGGGAGAAGGAAAGGGG + Intronic
1013589597 6:111608902-111608924 AGGAAAATAAATAAGGATAGAGG + Intergenic
1013604551 6:111735636-111735658 GGGAGAAAAGAGAAGCATGGGGG + Intronic
1013814035 6:114076249-114076271 AGGAAAAAACAGAAGATCAGGGG - Intronic
1013838260 6:114358805-114358827 GGGAGAAAATAGAAGGTTATGGG + Intergenic
1013947412 6:115737425-115737447 TGGAGAAACCAGACTGATAGTGG - Intergenic
1014755117 6:125294000-125294022 AGGAGAAGACTGGAGGATAAGGG - Intronic
1014856070 6:126402328-126402350 AGGAGAAGAAAGATGGAGAGGGG - Intergenic
1014941302 6:127442354-127442376 GGGAGAAAACACCAGGAAAGAGG - Exonic
1015405682 6:132834690-132834712 GGAAAAAAACAGAAGGGTAGAGG - Intergenic
1016538658 6:145138083-145138105 AGCAGAAAGCAGAAAGTTAGAGG - Intergenic
1016792029 6:148076106-148076128 TGTAGGAAACAGAAGGAGAGTGG - Intergenic
1017504766 6:155058081-155058103 AGGAAAAACCACAATGATAGGGG - Intronic
1017655697 6:156627198-156627220 AGCAGAAAAGAGAATGTTAGAGG + Intergenic
1017989277 6:159472089-159472111 AGAAGAAAACAGGAAGATAAGGG - Intergenic
1018304372 6:162439377-162439399 AGAAGAAAAAAGAAGCAGAGAGG - Intronic
1018524052 6:164687642-164687664 AGGAAGAAAGAGAAGGATGGAGG - Intergenic
1018539697 6:164864882-164864904 AGGATAAAACAGAAAGAAAATGG + Intergenic
1018648732 6:165972954-165972976 GGGAGAAGAGAGAAGGAGAGAGG - Intronic
1019089812 6:169519172-169519194 AGAAGAAAACAGAAAGATAAGGG - Intronic
1019619689 7:1985590-1985612 AGGAGAGAACATGAGGATGGCGG - Intronic
1020076538 7:5262478-5262500 AGGAGAAAAGAGAGGGAGAGAGG + Intergenic
1020080034 7:5282229-5282251 GGGAGAAAAGAGGAGGATGGAGG + Intronic
1020153792 7:5705079-5705101 AGGAGGAAAGAGGAGGAGAGGGG - Intronic
1020580588 7:9994700-9994722 AGGAGAAAAAAGAAAGAAAAGGG - Intergenic
1020871320 7:13632666-13632688 AGGTGAAACAAGAAGGGTAGAGG - Intergenic
1020977681 7:15027109-15027131 AGAAGAAAACATTAGCATAGAGG - Intergenic
1020983349 7:15099773-15099795 AGGAGAAAAGACAAAGATGGAGG + Intergenic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1021934964 7:25621220-25621242 AGGAGGAAACTGAAGGAATGAGG - Intergenic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1022651949 7:32285687-32285709 AGAAGAAGAAAGAAGGAGAGAGG + Intronic
1022726809 7:32988594-32988616 TGGAGAAAAGCGAAGGATTGTGG + Exonic
1022868190 7:34445111-34445133 AGGAGCAGAAAGAAGGCTAGTGG + Intergenic
1023133576 7:37028124-37028146 ATGAGAAAACAGAGGCACAGAGG + Intronic
1023224633 7:37956314-37956336 AGAAGAAAAAAGAAGGATGTAGG + Intronic
1023275120 7:38510584-38510606 ATGAGAAAACAGAGGCACAGAGG + Intronic
1023724797 7:43131878-43131900 AGGAGGAGACAGAAGGACAAAGG - Intronic
1024101776 7:46039597-46039619 AGAAGAAAACCTAAGGAAAGCGG - Intergenic
1024164317 7:46715160-46715182 TGGAGAAAAGGGAGGGATAGAGG - Intronic
1024225790 7:47325872-47325894 AAGTGGAAACAGAAGGGTAGAGG + Intronic
1024988730 7:55218524-55218546 AAGAGAAAAAGGAATGATAGAGG + Intronic
1025198882 7:56949987-56950009 GGGAGAAAAGAGGAGGATGGAGG - Intergenic
1025202548 7:56971107-56971129 AGGAGAAAAGAGAGGGAGAGAGG - Intergenic
1025321667 7:58100678-58100700 AGGAGAAAAAAGAAAGAAAAAGG + Intergenic
1025669401 7:63605820-63605842 AGGAGAAAAGAGAGGGAGAGAGG + Intergenic
1025673064 7:63626946-63626968 GGGAGAAAAGAGGAGGATGGAGG + Intergenic
1026062880 7:67041836-67041858 ATGAGAAAACGGAAGCACAGAGG - Intronic
1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG + Intergenic
1026157868 7:67843060-67843082 AGGACAAAGGAGAAGGAGAGAGG + Intergenic
1026218494 7:68370538-68370560 AGGAAAAAAAGGAAGGATAAAGG + Intergenic
1026675883 7:72427519-72427541 AGAAGAAAACAAAAGGACATTGG - Intronic
1026715471 7:72785572-72785594 ATGAGAAAACAGAAGCACAGAGG + Intronic
1026771569 7:73204251-73204273 GGGAGTAAACAGAAGGATAAGGG + Intergenic
1027012435 7:74757647-74757669 GGGAGTAAACAGAAGGATAAGGG + Intronic
1027075605 7:75188406-75188428 GGGAGTAAACAGAAGGATAAGGG - Intergenic
1027632388 7:80622400-80622422 AGGAGAACAAAGAAGAATAATGG + Intronic
1028343954 7:89757651-89757673 ATGAGAAAACTGAAGCACAGAGG + Intergenic
1028504173 7:91553448-91553470 ATGAGAAAACTGAAGCACAGAGG + Intergenic
1029118879 7:98253032-98253054 AGGAGAAAAAAGAAAGATGTCGG + Intronic
1029503873 7:100950370-100950392 CAGAGAAAAGAGAAGTATAGAGG - Intronic
1029928848 7:104348970-104348992 AGGAGAAAAAAGGAGAAGAGTGG - Intronic
1030006578 7:105126347-105126369 AGGAGAGAAAAAAAGGATATGGG + Intronic
1030161964 7:106518422-106518444 AGCAGAAAAGACAAGGAGAGGGG - Intergenic
1030735621 7:113044424-113044446 AGAAAGAAACAGAAAGATAGAGG - Intergenic
1031250944 7:119379698-119379720 AAGAGAAAAGAGAAAGATTGTGG - Intergenic
1031550480 7:123105545-123105567 AGGAGAAAAGAGCAAGAGAGGGG + Intergenic
1032327859 7:130949035-130949057 AGGAAAAAACATAAGCATAAGGG + Intergenic
1032355666 7:131208184-131208206 AGGAGGACACAGGAGGAAAGAGG + Intronic
1032493088 7:132339653-132339675 AGGAGAGAACAGGGGGAGAGAGG - Intronic
1033006622 7:137571817-137571839 AGAAGAATACAGATGGAAAGAGG + Intronic
1033057325 7:138070112-138070134 ATGAGAAAACAGAGACATAGAGG - Intronic
1033449647 7:141450948-141450970 AGGATAAAACAAAAGGTTACTGG + Intronic
1033847201 7:145448083-145448105 AGAAGAAAACAGGTGGATTGAGG - Intergenic
1034210335 7:149357670-149357692 AAGAGAAGAGAGAAGGAGAGAGG - Intergenic
1034408114 7:150919762-150919784 AGGACATATCACAAGGATAGAGG - Intergenic
1034653411 7:152710497-152710519 AGGAGAAAAGGGAAGGAAAGAGG + Intergenic
1034990204 7:155543154-155543176 AGGAGAAAAAAGCAGGCAAGGGG + Intergenic
1036782317 8:11658235-11658257 AGGTGAGAACAGGAGGAGAGTGG + Intergenic
1036792680 8:11732485-11732507 AAAACAAAACAGAAGGAGAGAGG + Intronic
1036991259 8:13598062-13598084 ATGAGAAAACTGAAGCCTAGTGG - Intergenic
1037007946 8:13805620-13805642 GGGAGAGAACAGGAGGACAGAGG - Intergenic
1037681796 8:21103840-21103862 AGAAGAAAACAGAAAGGAAGAGG + Intergenic
1037807908 8:22068729-22068751 AGGAGAAAAGGGGAGGAGAGAGG + Intronic
1038433541 8:27518924-27518946 AGAGGACAACAGCAGGATAGGGG - Intronic
1038659657 8:29486235-29486257 GGTAGAAAACAGGAGGGTAGAGG - Intergenic
1038954527 8:32452672-32452694 ATGGAAAAACAGAAGTATAGAGG + Intronic
1039114522 8:34077697-34077719 AGAATAGAATAGAAGGATAGTGG - Intergenic
1039800522 8:40950667-40950689 TGGAGAAAGCAGAAGGTGAGAGG + Intergenic
1039837396 8:41267710-41267732 ATGAGAAAACTGAGGCATAGGGG + Intronic
1039931000 8:41989031-41989053 AATAGAAAACAGGAGGAAAGTGG + Intronic
1040484839 8:47860219-47860241 AGGAGCATATAGAGGGATAGTGG + Intronic
1040637059 8:49287423-49287445 AGGAGAAGAGAGAAAGAAAGGGG - Intergenic
1040675895 8:49749679-49749701 AGGAGAAAACAAAGGGAGGGAGG + Intergenic
1041010005 8:53532369-53532391 GGGATAAAACAGAAGCACAGAGG + Intergenic
1041316837 8:56572799-56572821 AGGAGAATACAAAAGGGAAGTGG - Intergenic
1041435578 8:57837135-57837157 AGAAGAAAAGAGAAAGAAAGAGG - Intergenic
1042140717 8:65675692-65675714 GTGAGAAAACAGAAGCATAGAGG + Intronic
1042346367 8:67732180-67732202 GGGAGAAATCAGCAGGAGAGTGG + Intronic
1042349575 8:67763430-67763452 AAAAGAAAAAAGAAGGACAGAGG - Intergenic
1042449351 8:68926311-68926333 ATGAGAAAAATGAAGTATAGAGG + Intergenic
1042690089 8:71488265-71488287 AGGATAAAAAATAAGGATATAGG + Intronic
1042970531 8:74403330-74403352 AGGAGGAAATAGAAGAAGAGGGG + Intronic
1043204858 8:77425481-77425503 AGGAGAAGACAGAAAGATGCAGG + Intergenic
1043753782 8:83975733-83975755 AGGAAAAAAGAGGAGGGTAGAGG + Intergenic
1043933332 8:86115317-86115339 AAGAAAGAATAGAAGGATAGAGG - Intronic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1044756033 8:95461991-95462013 AGGAGAGAAGAGGAGGAGAGAGG - Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1045005276 8:97911997-97912019 AAGAGGAAACTGAAGGAGAGAGG + Intronic
1045023138 8:98061797-98061819 AGGAGGAGAAAGAAGGAGAGAGG + Intergenic
1045176740 8:99733251-99733273 AACAGCAAACAGAAGGAAAGAGG + Intronic
1045652283 8:104352458-104352480 AGGAGAACACAGGAGGAGAATGG - Intronic
1045697892 8:104831275-104831297 ACGAGGAAACAGAAGGAAAAGGG + Intronic
1046313291 8:112466971-112466993 ATGAGAAATAAGAAAGATAGTGG + Intronic
1046541138 8:115585444-115585466 AGTAGAAAAAGGAAGGAAAGGGG + Intronic
1046569357 8:115943525-115943547 ATGAGAAAATGGAAAGATAGAGG - Intergenic
1048183310 8:132215883-132215905 AGCAGAGAAGAGAAGGAGAGAGG - Intronic
1048195916 8:132331573-132331595 AGGAGAAATCAGAAGAGAAGAGG - Intronic
1048480774 8:134790599-134790621 AGGAGAAAACAGAAGGTGTGAGG - Intergenic
1048650685 8:136473229-136473251 AGAAGAAAACAGTAGAACAGAGG + Intergenic
1049916920 9:326771-326793 AGAAGAGAAAAGAAGGATGGAGG + Intronic
1050046949 9:1556810-1556832 AAGAGCAAGCAGAAGGCTAGAGG + Intergenic
1050631634 9:7565285-7565307 AGAAGAAAAGGGAAGGAGAGAGG - Intergenic
1050643303 9:7692366-7692388 AGAAGAAGACAGAAAGATATGGG + Intergenic
1051048050 9:12899137-12899159 AGGAGAAGAGGGAAGGAAAGAGG - Intergenic
1051183452 9:14435460-14435482 ATGAGAAAACAGAGGCACAGAGG - Intergenic
1051502699 9:17795497-17795519 AGAAGAACACAAAAGGATAAGGG - Intronic
1051698090 9:19789873-19789895 GGGAGAGAACAGAAGGATGGAGG - Intergenic
1051874431 9:21776514-21776536 AGGAGAAAAAAGATGATTAGAGG + Intergenic
1051933494 9:22414881-22414903 AAGAGAAAACAAAAGAATAGAGG - Intergenic
1053282883 9:36832430-36832452 AGGACAGGACAGAAGGATTGTGG + Intergenic
1053845037 9:42227524-42227546 AGGAGAAATAAGAAGGAGAGAGG - Intergenic
1054998565 9:71422044-71422066 GGGAGAAAACACAGGGAAAGAGG - Intronic
1055015275 9:71610262-71610284 AGGAGTAAATAGAAGGAAAACGG + Intergenic
1055274092 9:74594797-74594819 AAGAGAAAAAGGAAGGAAAGAGG + Intronic
1055372355 9:75613621-75613643 AAAAGAAAACAGAAGGAAAATGG - Intergenic
1056620051 9:88204990-88205012 AGGAAGAAAGAGAATGATAGGGG + Intergenic
1056702518 9:88922844-88922866 AGGAGAAAGAAGAAGAAAAGGGG - Intergenic
1057044739 9:91876812-91876834 AGGAGAAGAAAGAAGTAAAGAGG + Intronic
1057159272 9:92875060-92875082 CTGAGAAAACAGATGGGTAGAGG + Intronic
1057544398 9:96006646-96006668 AGGTGAAAACAGAAAGAGGGAGG + Intronic
1057555084 9:96081673-96081695 AGGTGAAAAGTGAAGGATTGAGG - Intergenic
1057824410 9:98361039-98361061 AGGAGAAAAAAGTAGAATAATGG - Intronic
1058078403 9:100674225-100674247 GGGTGAAAACAGATGGAAAGGGG + Intergenic
1058403854 9:104649148-104649170 AGGGGAAAAAAGCAGGTTAGAGG + Intergenic
1058622420 9:106897795-106897817 AGGAGAATAGAGAGGGAAAGAGG + Intronic
1058944299 9:109841890-109841912 AGGAGAAGTTGGAAGGATAGAGG + Intronic
1059426037 9:114221612-114221634 ACGAGAAAACTGAGGTATAGGGG + Intronic
1059518668 9:114919427-114919449 AGGAGTTAACAGAAGCAGAGAGG + Intronic
1059563683 9:115360752-115360774 AGAAGAAAACAGAAGCCTGGTGG + Intronic
1059589419 9:115641961-115641983 AGGAGAAAAGAAAAGGAGAATGG - Intergenic
1059619252 9:115985245-115985267 AGGAGAAAACTGAGGGTAAGAGG - Intergenic
1059684763 9:116624491-116624513 ATGAGAATACAGAAGGAAGGGGG + Intronic
1059768359 9:117404851-117404873 GGGAAAAAAAAGAAGGAAAGGGG + Intronic
1059933861 9:119288167-119288189 GGGAGAAAAAAGAAGGACAATGG - Intronic
1060128183 9:121070685-121070707 AGGAGTAAACAGTAGAACAGAGG + Intergenic
1061254345 9:129445400-129445422 AGAAGAGAAGAGAAGAATAGAGG - Intergenic
1061321073 9:129829958-129829980 AGAAGAAAACAGAAGAATAAAGG + Intronic
1062065273 9:134523382-134523404 AGGAAAAGAAAGAAGGAGAGAGG - Intergenic
1062144021 9:134978978-134979000 AGGAGAAAAGAGAGGGAGGGAGG + Intergenic
1062304159 9:135893186-135893208 AAGAGAGAAGAGAAGGAGAGAGG + Intronic
1062617294 9:137403585-137403607 AGGGGCAAAGAGAAGGAGAGAGG - Intronic
1185590353 X:1272344-1272366 TTGAGACTACAGAAGGATAGGGG + Intronic
1185774855 X:2794096-2794118 AGGAGGAAGCAGAGGGAAAGGGG + Intronic
1186107102 X:6219414-6219436 AAGAGAAAAAGGAAGGAGAGAGG - Intronic
1186139332 X:6554566-6554588 AGAAGAAAAGTGAAGAATAGGGG - Intergenic
1186457348 X:9720395-9720417 AGGACAAAGCAGATGGCTAGGGG + Intergenic
1187167542 X:16818536-16818558 AGGAGAAAAAAGATGGAGAAGGG - Intronic
1187201265 X:17135662-17135684 AGGAAACAACAGAAGGTGAGAGG - Intronic
1187301552 X:18055473-18055495 AGTAGGTAACAGAAGGATAGAGG + Intergenic
1187393983 X:18904215-18904237 AGTGGAAAACAGAAGGAGAAGGG + Intronic
1187704312 X:21994083-21994105 AGTAGACAACAGAAGGCTAAAGG - Intronic
1187853969 X:23618908-23618930 AGGAGAAATCAGAGAAATAGGGG - Intergenic
1188000627 X:24977434-24977456 AGGAGAAAAAAAAAGGACACAGG - Intronic
1188036311 X:25321374-25321396 ATGAGAAAACAGAGGCAGAGAGG + Intergenic
1188047922 X:25449527-25449549 AGAAGAAGACAGAAAGATATGGG + Intergenic
1188248128 X:27858229-27858251 AGGAGTAAACAGAAAGACAAGGG - Intergenic
1188446294 X:30256406-30256428 AGAAGGAACCAGAAGGAGAGAGG + Intergenic
1189197125 X:39162150-39162172 AGGAGAGGAAAGAAGGAAAGAGG - Intergenic
1189801820 X:44698573-44698595 AAGAGAAAACTGCAGGGTAGCGG - Intergenic
1190066705 X:47246472-47246494 AGAGGAAACTAGAAGGATAGAGG + Intronic
1190141280 X:47847407-47847429 AGGAGAAAACTGGGGCATAGGGG + Intronic
1190367596 X:49711526-49711548 GGGAGACAAGAGAAGGTTAGAGG - Intergenic
1190392686 X:49947684-49947706 AGAAGAAACCAGAAGAAAAGAGG - Intronic
1190735768 X:53255256-53255278 ATGAGAAAGGAGAAGGAGAGAGG + Intronic
1191089988 X:56609609-56609631 AGAAGAAAACAGAAAGATGTGGG - Intergenic
1191659690 X:63636631-63636653 AGGAGAAAGAAGAAAGAGAGAGG + Exonic
1191738087 X:64408269-64408291 AGAAGAAAACAGAAAGATGAGGG - Intergenic
1191923306 X:66280019-66280041 AGGAGAAGACAGAAAAATATGGG - Intergenic
1192034746 X:67549877-67549899 AGGAGAGAGGAGAAGGAAAGAGG - Intronic
1192197341 X:69037240-69037262 AAGAGAAAAAAGAAAGAGAGAGG - Intergenic
1192218918 X:69183556-69183578 AGGAGAAGACAGTAGGTTTGGGG - Intergenic
1192531936 X:71895587-71895609 AAGAGAAAAGAAAAGGAAAGAGG + Intergenic
1192656327 X:72998826-72998848 GGGAGAAATCAGAAGGAGTGGGG - Intergenic
1192665793 X:73084175-73084197 GGGAGAAATCAGAAGGAGTGGGG + Intergenic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1193173619 X:78365987-78366009 TTGAGAAAACTGAAGGAAAGAGG + Intergenic
1193491961 X:82161479-82161501 AGAAGAAGACAGAAAGATAAGGG + Intergenic
1193501172 X:82276549-82276571 AGGAGAAGACAGAAAGATGTGGG - Intergenic
1193678746 X:84490164-84490186 AAGAGAAAAAAAAAGGAGAGAGG - Intronic
1193867966 X:86760779-86760801 AGGAAAAAAAAAAAGGACAGAGG - Intronic
1194912107 X:99658227-99658249 AGGAAAAAACAGAAAAAGAGAGG + Intergenic
1195140833 X:101957929-101957951 AGGAGAAAACAGACTAATACAGG + Intergenic
1195457702 X:105087691-105087713 ATGAGAAAACAGAGAGAAAGAGG - Intronic
1196246636 X:113407392-113407414 AGTAGGAAACACAAGGAAAGAGG - Intergenic
1197373283 X:125650585-125650607 AGCAGAAAAAAGAATGGTAGTGG - Intergenic
1197434951 X:126415819-126415841 AGGAGAAAATAAAATGATATTGG + Intergenic
1198728970 X:139707088-139707110 AGATGAAAAAAGAAGGATGGAGG + Intronic
1199007117 X:142713485-142713507 AGAAGTAAAGAGAAGAATAGTGG + Intergenic
1199126445 X:144127677-144127699 GGCAGAAATCAGAGGGATAGAGG - Intergenic
1199917953 X:152364637-152364659 AGTAGAAAACAAAGGGAGAGAGG + Intronic
1200032775 X:153309836-153309858 AGGAGAAAAAAGAAGAAAAGTGG + Intergenic
1200132710 X:153859902-153859924 TGCAGAAAACAGGAGGAGAGAGG + Intergenic
1200808597 Y:7459116-7459138 AGGAGAAAGAAGAAGGAAAAAGG - Intergenic
1201123831 Y:10894675-10894697 AGGAAATAACAGAAGTGTAGTGG - Intergenic
1201409907 Y:13689219-13689241 AGGAGATAGGAGAAGGGTAGGGG - Intergenic
1201465505 Y:14275986-14276008 AGGAGAAAAAAGGGGGAGAGGGG - Intergenic
1201905397 Y:19081394-19081416 AGCAGAAAACAGAGAGACAGAGG + Intergenic
1202096415 Y:21253084-21253106 AGGAGAGTACAGAAGGAAAGTGG - Intergenic
1202110803 Y:21417203-21417225 AGGAGAAGAGAGAAGGACACAGG + Intergenic