ID: 913314954

View in Genome Browser
Species Human (GRCh38)
Location 1:117541721-117541743
Sequence GAATACTCCTTGGCCTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913314950_913314954 13 Left 913314950 1:117541685-117541707 CCAGCAAAGTATCTTGAAAAGTG No data
Right 913314954 1:117541721-117541743 GAATACTCCTTGGCCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913314954 Original CRISPR GAATACTCCTTGGCCTCTCC AGG Intergenic
No off target data available for this crispr