ID: 913316254

View in Genome Browser
Species Human (GRCh38)
Location 1:117555551-117555573
Sequence GAGAGGAGTTTTCAGTGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913316251_913316254 -3 Left 913316251 1:117555531-117555553 CCTCATTTATTTGAGTGATTGAG No data
Right 913316254 1:117555551-117555573 GAGAGGAGTTTTCAGTGGATAGG No data
913316250_913316254 -2 Left 913316250 1:117555530-117555552 CCCTCATTTATTTGAGTGATTGA No data
Right 913316254 1:117555551-117555573 GAGAGGAGTTTTCAGTGGATAGG No data
913316249_913316254 23 Left 913316249 1:117555505-117555527 CCAGGAAGTGGAAAATGATGGAA No data
Right 913316254 1:117555551-117555573 GAGAGGAGTTTTCAGTGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913316254 Original CRISPR GAGAGGAGTTTTCAGTGGAT AGG Intergenic
No off target data available for this crispr