ID: 913316791

View in Genome Browser
Species Human (GRCh38)
Location 1:117560550-117560572
Sequence GATCTGATTTCTATCATCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913316791_913316794 -6 Left 913316791 1:117560550-117560572 CCTATGATGATAGAAATCAGATC No data
Right 913316794 1:117560567-117560589 CAGATCAGTGGTTGCTTAGGAGG No data
913316791_913316798 13 Left 913316791 1:117560550-117560572 CCTATGATGATAGAAATCAGATC No data
Right 913316798 1:117560586-117560608 GAGGTAGAATTGACTAGGAGGGG No data
913316791_913316796 11 Left 913316791 1:117560550-117560572 CCTATGATGATAGAAATCAGATC No data
Right 913316796 1:117560584-117560606 AGGAGGTAGAATTGACTAGGAGG No data
913316791_913316795 8 Left 913316791 1:117560550-117560572 CCTATGATGATAGAAATCAGATC No data
Right 913316795 1:117560581-117560603 CTTAGGAGGTAGAATTGACTAGG No data
913316791_913316800 21 Left 913316791 1:117560550-117560572 CCTATGATGATAGAAATCAGATC No data
Right 913316800 1:117560594-117560616 ATTGACTAGGAGGGGGCATGAGG No data
913316791_913316793 -9 Left 913316791 1:117560550-117560572 CCTATGATGATAGAAATCAGATC No data
Right 913316793 1:117560564-117560586 AATCAGATCAGTGGTTGCTTAGG No data
913316791_913316797 12 Left 913316791 1:117560550-117560572 CCTATGATGATAGAAATCAGATC No data
Right 913316797 1:117560585-117560607 GGAGGTAGAATTGACTAGGAGGG No data
913316791_913316799 14 Left 913316791 1:117560550-117560572 CCTATGATGATAGAAATCAGATC No data
Right 913316799 1:117560587-117560609 AGGTAGAATTGACTAGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913316791 Original CRISPR GATCTGATTTCTATCATCAT AGG (reversed) Intergenic
No off target data available for this crispr