ID: 913316798

View in Genome Browser
Species Human (GRCh38)
Location 1:117560586-117560608
Sequence GAGGTAGAATTGACTAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913316791_913316798 13 Left 913316791 1:117560550-117560572 CCTATGATGATAGAAATCAGATC No data
Right 913316798 1:117560586-117560608 GAGGTAGAATTGACTAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913316798 Original CRISPR GAGGTAGAATTGACTAGGAG GGG Intergenic
No off target data available for this crispr