ID: 913329216

View in Genome Browser
Species Human (GRCh38)
Location 1:117653389-117653411
Sequence CTGCCTAGATGCCGCTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913329216_913329225 22 Left 913329216 1:117653389-117653411 CCAGCTGAGCGGCATCTAGGCAG No data
Right 913329225 1:117653434-117653456 GGGCACACAGCACCCCTCCTAGG No data
913329216_913329223 2 Left 913329216 1:117653389-117653411 CCAGCTGAGCGGCATCTAGGCAG No data
Right 913329223 1:117653414-117653436 CCTGGCCTCTTGGAAGAAGAGGG No data
913329216_913329226 23 Left 913329216 1:117653389-117653411 CCAGCTGAGCGGCATCTAGGCAG No data
Right 913329226 1:117653435-117653457 GGCACACAGCACCCCTCCTAGGG No data
913329216_913329219 -8 Left 913329216 1:117653389-117653411 CCAGCTGAGCGGCATCTAGGCAG No data
Right 913329219 1:117653404-117653426 CTAGGCAGGCCCTGGCCTCTTGG No data
913329216_913329221 1 Left 913329216 1:117653389-117653411 CCAGCTGAGCGGCATCTAGGCAG No data
Right 913329221 1:117653413-117653435 CCCTGGCCTCTTGGAAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913329216 Original CRISPR CTGCCTAGATGCCGCTCAGC TGG (reversed) Intergenic
No off target data available for this crispr