ID: 913331418

View in Genome Browser
Species Human (GRCh38)
Location 1:117671236-117671258
Sequence AGGGGGAAGGGACTGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913331407_913331418 12 Left 913331407 1:117671201-117671223 CCCTTTCATTTAACAAATGAGGA No data
Right 913331418 1:117671236-117671258 AGGGGGAAGGGACTGGCCCAGGG No data
913331408_913331418 11 Left 913331408 1:117671202-117671224 CCTTTCATTTAACAAATGAGGAA No data
Right 913331418 1:117671236-117671258 AGGGGGAAGGGACTGGCCCAGGG No data
913331405_913331418 15 Left 913331405 1:117671198-117671220 CCACCCTTTCATTTAACAAATGA No data
Right 913331418 1:117671236-117671258 AGGGGGAAGGGACTGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913331418 Original CRISPR AGGGGGAAGGGACTGGCCCA GGG Intergenic
No off target data available for this crispr